ID: 1104735718

View in Genome Browser
Species Human (GRCh38)
Location 12:131135040-131135062
Sequence AAGGCAGAAGGTCCCTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 340}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104735715_1104735718 9 Left 1104735715 12:131135008-131135030 CCGCTAGTCTCTAGACTTTTCTC 0: 1
1: 0
2: 1
3: 10
4: 197
Right 1104735718 12:131135040-131135062 AAGGCAGAAGGTCCCTGCTGTGG 0: 1
1: 0
2: 4
3: 26
4: 340
1104735714_1104735718 26 Left 1104735714 12:131134991-131135013 CCTGGGCAGCAGGAACTCCGCTA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1104735718 12:131135040-131135062 AAGGCAGAAGGTCCCTGCTGTGG 0: 1
1: 0
2: 4
3: 26
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104735718 Original CRISPR AAGGCAGAAGGTCCCTGCTG TGG Intronic
901068796 1:6507199-6507221 AAGCCACAATGACCCTGCTGGGG - Intronic
901772473 1:11537308-11537330 AAGACAGAAGGACCCGGCTTGGG + Exonic
902836943 1:19053560-19053582 GAGGCACGAGGGCCCTGCTGAGG - Intergenic
903018087 1:20374828-20374850 AAGCCACATGGTGCCTGCTGTGG + Intergenic
904370074 1:30042697-30042719 AAGGGGGCAGGTCCCTGGTGAGG + Intergenic
904461024 1:30679870-30679892 AAGGTGGCAGGTCCCTGATGAGG + Intergenic
907609500 1:55854142-55854164 CAGTCAGAAGGTCTATGCTGTGG + Intergenic
907761796 1:57368302-57368324 AAGGGGGCAGGTCCCTGGTGAGG + Intronic
907976527 1:59436266-59436288 AGGGCAGAGGGTGCCTGCCGTGG - Intronic
908327354 1:63036256-63036278 AAGGAAGGGGGTCCCTGCTGAGG - Intergenic
908512047 1:64857429-64857451 AAGGAAGAAGGGCCCTACAGGGG + Intronic
908713534 1:67044924-67044946 AAGGCAGTACGGCCATGCTGAGG - Intronic
910642706 1:89480858-89480880 CAGGCAGAAGTTTCCTGCAGGGG - Intergenic
911007610 1:93243167-93243189 CAGGCAGAAGTTTGCTGCTGAGG - Intronic
911587859 1:99711621-99711643 AAGGTAGAAGGTGCCTACTTAGG + Intronic
912130979 1:106599991-106600013 AAGGCAGAAATTCCCAGATGTGG + Intergenic
912763240 1:112386811-112386833 AAGGGGGCAGGTCCCTGGTGAGG + Intergenic
915091578 1:153429795-153429817 AAGGCAAGAGGACTCTGCTGGGG - Intergenic
915588206 1:156856510-156856532 GAGGCTGAAGGACCCTTCTGAGG - Intronic
915590156 1:156866237-156866259 GAGGCAGAGGGTCCCAGCAGCGG + Intronic
916265278 1:162884471-162884493 AAAGCAGAATGTCCCTGGGGTGG + Intergenic
917930131 1:179817264-179817286 GTGGCTGAAGGGCCCTGCTGAGG + Intergenic
919575274 1:199300868-199300890 AGGACAGATGGTCCCTGCTATGG + Intergenic
920181161 1:204132295-204132317 AAGCCAGGTGGGCCCTGCTGGGG + Intronic
920799273 1:209172589-209172611 CAGGGAGAAGGTCCAAGCTGAGG + Intergenic
921791378 1:219294434-219294456 AAGACAGAAGCTCCCAACTGTGG + Intergenic
923142782 1:231175329-231175351 AAGGCAGGAAGACCCTGCAGGGG + Intronic
923398574 1:233591736-233591758 AAGGCTGATGGTGCCTTCTGTGG - Intergenic
1066657114 10:37706175-37706197 AAGGATGAAGTTCCCTCCTGTGG - Intergenic
1067344449 10:45427634-45427656 AAGGGTGAGGGTCCCGGCTGCGG - Intronic
1067548711 10:47217596-47217618 AAGGCACAAAGTCCATGCTCAGG + Intergenic
1067550117 10:47228225-47228247 AAGGGAGAAAGTCCATGCTCAGG + Intergenic
1067768973 10:49109979-49110001 ACGGCAGGAGCTCCCTGGTGAGG + Intronic
1067945609 10:50686413-50686435 AAAGCAGATGCTCCTTGCTGTGG + Intergenic
1068282587 10:54894766-54894788 GAAGCAGAAGGTGCCTGCTTTGG - Intronic
1068452648 10:57211983-57212005 CAGGCAGAAGTTCGCTGCAGGGG - Intergenic
1069919312 10:71806902-71806924 AAGGCTGAGGGCCCCTCCTGTGG + Intronic
1070629048 10:78071390-78071412 AAGCCAGTTGGTGCCTGCTGGGG - Intergenic
1070867122 10:79713286-79713308 AAAGCAGATGCTCCTTGCTGTGG + Intronic
1070880912 10:79851407-79851429 AAAGCAGATGCTCCTTGCTGTGG + Intergenic
1071520621 10:86329695-86329717 TCAGCAGAAGGGCCCTGCTGGGG + Intronic
1071634037 10:87235510-87235532 AAAGCAGATGCTCCTTGCTGTGG + Intronic
1071647483 10:87367727-87367749 AAAGCAGATGCTCCTTGCTGTGG + Intronic
1072935052 10:99704230-99704252 AAGCCTGGAGGTCCCTTCTGGGG + Intronic
1073922111 10:108470930-108470952 AAGGCAGAAGTTTGCTGCAGGGG - Intergenic
1076014723 10:127018540-127018562 AAGGCAAAAGGTGCCTGTCGTGG - Intronic
1076249270 10:128972465-128972487 AAGGCAGCAGTTCACTCCTGGGG + Intergenic
1076368508 10:129936884-129936906 AAGGCAGGAGGGCCATGCTTTGG + Intronic
1076514154 10:131033785-131033807 AAGGCAGGGTGTCCCTGCAGTGG + Intergenic
1076742590 10:132494167-132494189 CAGGCAGGAGGTGCCTCCTGGGG - Intergenic
1076812090 10:132892093-132892115 CAGTCAGAAGGTCCCGGCTCTGG + Intronic
1077498633 11:2898723-2898745 AGTGCAGGAGGTCTCTGCTGTGG - Intronic
1079885542 11:25983818-25983840 AGGGAAGAAAGTCCCTACTGAGG - Intergenic
1080065128 11:28002324-28002346 CAGGCAGAAGTTCTCTGCAGGGG + Intergenic
1081761137 11:45577094-45577116 AAGGGACAAGGACCCTGTTGTGG - Intergenic
1081794586 11:45810767-45810789 AAGCCAGAAGCCCCCTGCAGTGG - Exonic
1085588222 11:77731847-77731869 CAGGCAGAAGTTTCCTGCAGGGG + Intronic
1088079952 11:105900075-105900097 AACACACAAGGTCCCAGCTGTGG - Intronic
1088757783 11:112900769-112900791 AAGTCAGAAGATCCCAGCTGCGG + Intergenic
1089336256 11:117725867-117725889 CAGGCAGCAGGTCCCAGCAGAGG + Intronic
1089509125 11:118984809-118984831 GAGGCTGCAGGTCCCAGCTGGGG + Intergenic
1090603559 11:128397357-128397379 GAGGCTGGTGGTCCCTGCTGAGG - Intergenic
1090961975 11:131565201-131565223 GAGGCAGGAGGTCCCTGGAGAGG - Intronic
1092247805 12:6873190-6873212 AAGGGGGATGGTCCATGCTGAGG - Intronic
1092317522 12:7433643-7433665 AATGGAGACGGTCCCTGCTCTGG - Exonic
1093652068 12:21657523-21657545 AAGGCAGAGGGTAGCAGCTGCGG - Exonic
1095108013 12:38258896-38258918 AAGCCAGAAAGTCCCTGTGGTGG + Intergenic
1095919405 12:47514262-47514284 CAGGCAGAAGTTTCCTGCAGGGG + Intergenic
1096628484 12:52910155-52910177 TAGGCGGAAGGTCCCAGCTATGG + Intronic
1097306402 12:58073993-58074015 AAGGCAGAAGTCCCATGCTAAGG - Intergenic
1097381907 12:58905516-58905538 AAGGCTGCAGTCCCCTGCTGTGG + Intronic
1099096314 12:78379001-78379023 AAGGCAGAAGATATCTGCAGGGG - Intergenic
1099326025 12:81215326-81215348 AAGCCATATGGTCACTGCTGAGG - Intronic
1100657961 12:96667373-96667395 CAGGCAGAAGTTTCCTGCAGGGG - Intronic
1104600938 12:130152851-130152873 AAGGCAGAAGGAGCCTCCTCTGG - Intergenic
1104735718 12:131135040-131135062 AAGGCAGAAGGTCCCTGCTGTGG + Intronic
1105650518 13:22372201-22372223 CAGGCAGAAGGTTGCTGCAGGGG - Intergenic
1105726587 13:23168499-23168521 AAGGCACGAGCACCCTGCTGGGG - Intergenic
1106057994 13:26255889-26255911 AAAGCTGAAGTTCCCTACTGTGG + Intronic
1108438874 13:50428310-50428332 AATACAGAATGTCCCTGATGGGG - Intronic
1108701737 13:52949719-52949741 AGGGCAAACGGTCCCTGATGGGG + Intergenic
1108936772 13:55891417-55891439 CAGGCAGAAGTTTCCTGCAGGGG - Intergenic
1109294439 13:60513022-60513044 AAGGCAGAAGTTTGCTGCAGGGG - Intronic
1109614167 13:64808911-64808933 CAGGCAGAAGTTCACTGCAGAGG + Intergenic
1109814940 13:67569160-67569182 AAGGAAGAAGCTCAATGCTGAGG - Intergenic
1110148344 13:72221281-72221303 ACTGCTGTAGGTCCCTGCTGTGG - Intergenic
1111404203 13:87780877-87780899 GAGACAGAATGTTCCTGCTGAGG + Intergenic
1111693189 13:91591246-91591268 AAGCAAGAAGGTCCCTGAGGAGG - Intronic
1111842955 13:93473162-93473184 AAGGGGGCAGGTCCCTGGTGAGG - Intronic
1112055285 13:95684938-95684960 CAGGCAGAAGGTTGCTGCAGGGG + Intronic
1112882364 13:104123395-104123417 CAGGCAGAAGTTTGCTGCTGGGG + Intergenic
1113074390 13:106453464-106453486 AAGGGAGAAGGAAACTGCTGAGG + Intergenic
1114778425 14:25512686-25512708 AAGGCAGAAGCTCCCTGATATGG - Intergenic
1116039507 14:39668741-39668763 AAGCCAGAAGAACCCTGATGTGG - Intergenic
1117802639 14:59461082-59461104 AAGCCACAAGGTCCTTGCTGAGG + Exonic
1118973326 14:70655617-70655639 AAGACAGGAGGTCCCTGCAGTGG - Intronic
1120101565 14:80450814-80450836 AAGGCAGAAGTTTGCTGCAGTGG + Intergenic
1121506311 14:94480139-94480161 CAGGATGAAGATCCCTGCTGGGG - Intergenic
1122420599 14:101574247-101574269 AAGGCAGAAGGTAAGTGTTGGGG + Intergenic
1124256949 15:28152054-28152076 CAGGCAGGAGGTGCCTGCTGAGG + Intronic
1124257013 15:28152641-28152663 AAGGCTGCAGCTCCCCGCTGGGG + Intronic
1124567382 15:30828476-30828498 CAGGCAGGAGGTGCCTGCTGAGG - Intergenic
1124624685 15:31301135-31301157 ATGGGAGAAGGTCCCAGCTCAGG - Intergenic
1125153615 15:36562010-36562032 AAGGCAGAAGTTTGCTGCAGGGG + Intergenic
1125893820 15:43285729-43285751 AAGGCAGCAGCTCCCTCTTGTGG + Intronic
1127300998 15:57653716-57653738 AAAGCAGAAAGTCCCTACTTAGG + Intronic
1127887902 15:63219655-63219677 AAGGCAGAAAGCCACTGCTGTGG + Intronic
1130070870 15:80645694-80645716 TAAGCAGAAGGTGTCTGCTGTGG + Intergenic
1130109073 15:80950069-80950091 AAGGCAGGAGCTCACTTCTGTGG - Exonic
1132181575 15:99757153-99757175 AAGGAAGATGGACACTGCTGTGG - Intergenic
1132206372 15:99988752-99988774 AAGGCTGAAGGTCCTGTCTGGGG + Intronic
1132667108 16:1086546-1086568 TAGCCAGAAGGTAGCTGCTGTGG - Intergenic
1136153276 16:28365908-28365930 AAAGAAGAAGGTGCATGCTGGGG + Intergenic
1136209810 16:28749359-28749381 AAAGAAGAAGGTGCATGCTGGGG - Intergenic
1136561232 16:31040299-31040321 AAGGCAGAACCAGCCTGCTGTGG - Intronic
1137562316 16:49510802-49510824 AAGGCATGTGGTCCCGGCTGAGG + Intronic
1137669752 16:50272206-50272228 AAGGCAGAAGGTACCTGCAGTGG + Intronic
1138556001 16:57771559-57771581 AAGCCAGCAGGTCCCTGCCCAGG - Exonic
1138776508 16:59729846-59729868 AAGGCAGGAGGGGTCTGCTGGGG - Intronic
1141303701 16:82841043-82841065 AAGGCAAATGGTACTTGCTGGGG + Intronic
1142291230 16:89194481-89194503 AAGGCAGACGGGCCGTTCTGCGG + Intronic
1142955144 17:3516428-3516450 AAGGGAGAAGGGCCCTGGGGTGG - Intronic
1143457172 17:7075860-7075882 AGGGCAGCAGGTCCCTTCAGTGG + Exonic
1144401391 17:14906292-14906314 TAGGCAGAAGCTTCCTGGTGAGG + Intergenic
1144438065 17:15258981-15259003 AAGCCAGAATGTCGTTGCTGGGG - Intronic
1144812541 17:18009899-18009921 AAAGCAGAACGTACATGCTGAGG + Intronic
1145268590 17:21392426-21392448 GAGGCAGAGGGCCCCTGTTGGGG - Intronic
1146130249 17:30266987-30267009 AAGCCAGATTCTCCCTGCTGAGG + Intronic
1146143283 17:30388305-30388327 AAGGGAGGGGGTCCCTGGTGAGG - Intronic
1146602213 17:34227717-34227739 GAAGTAGAAGGTGCCTGCTGGGG - Intergenic
1148593015 17:48830884-48830906 AAGGCAGAAGACCGCTCCTGGGG + Intergenic
1148854327 17:50570445-50570467 GCTGCAGATGGTCCCTGCTGTGG + Intronic
1148965483 17:51431462-51431484 AAGGCAGAAGATCAATGCTGAGG - Intergenic
1150132800 17:62678434-62678456 AAGGCAGTAGGTGCCCCCTGAGG + Intronic
1150950942 17:69801738-69801760 AAGGGAACAGGTCCCTGGTGAGG + Intergenic
1151352549 17:73540217-73540239 GAGGGAGCAGGGCCCTGCTGAGG + Intronic
1151500974 17:74488668-74488690 CAGGCAGAAGGTTGCTGCAGGGG - Intergenic
1151733166 17:75922883-75922905 AAGACAGAGGGTCCCTGAGGTGG - Intronic
1152603979 17:81279515-81279537 AAGGAGGGATGTCCCTGCTGGGG + Intronic
1155878453 18:31114944-31114966 AAAGCAGAAGGCCACTGCTTGGG - Intergenic
1157275171 18:46305106-46305128 GAGGCAGAAGGTCCCTGGAAGGG + Intergenic
1157575848 18:48742473-48742495 AATGCAGAAGGTGCCTCCTCTGG - Intronic
1157878138 18:51292664-51292686 AAGGGAGAAGGTGTCTGCTAGGG + Intergenic
1158118896 18:54026435-54026457 AAGGTAGATTGTCCATGCTGGGG + Intergenic
1159007238 18:63023968-63023990 AGAGGAGAAGGTCCTTGCTGAGG - Intergenic
1159196460 18:65122513-65122535 CAGGCAGAAGTTCGCTGCAGGGG + Intergenic
1160565109 18:79782171-79782193 GAGGGAGAAGGTCCCTCCTAAGG - Intergenic
1160657179 19:279556-279578 AAGCCAGAAGGGCCCAGCTTTGG - Intergenic
1160661541 19:301770-301792 TAGGCAGAATGTCACTGCAGAGG + Intergenic
1160834862 19:1119853-1119875 CAGGCAGAAAGACGCTGCTGCGG + Intronic
1162438982 19:10681060-10681082 AAGGCAGAGGGTCCATGCCTAGG - Exonic
1165258442 19:34594003-34594025 GAGGCAGGAGGGCCCTGTTGGGG + Intronic
1166141014 19:40805236-40805258 AAGACAGATGGTCCGGGCTGGGG + Intronic
1167739640 19:51316819-51316841 AAGGGAGGAGGACCCTCCTGGGG + Intronic
925045199 2:767622-767644 CAACCAGAAGGCCCCTGCTGTGG - Intergenic
925408511 2:3625284-3625306 CAGGCCTCAGGTCCCTGCTGAGG + Intronic
926924590 2:17974489-17974511 AAGGCAGAATGTTCCTTTTGAGG + Intronic
927266928 2:21162274-21162296 AAGGAAGGAGGTCCCTGATAAGG - Intergenic
928322501 2:30294973-30294995 GAGGCCCAGGGTCCCTGCTGGGG - Intronic
928938708 2:36706207-36706229 AAAGCAGAAGGTCCCTAGAGAGG - Intronic
929030679 2:37647723-37647745 AAGGCAATAGGTCCCTGATTAGG + Intronic
929382493 2:41369011-41369033 AAGGCAGAAGTTTGCTGCAGGGG - Intergenic
929615531 2:43304343-43304365 AAGGCAGAAGGATCCTCCTCAGG + Intronic
929778718 2:44944011-44944033 CAGGCAGAAGGTTCCCGGTGGGG + Intronic
931500041 2:62855463-62855485 AAGGAGGAAGGTCTCTGGTGAGG + Intronic
931789771 2:65654505-65654527 AAGGCAAAACCTCCCAGCTGTGG + Intergenic
932421562 2:71604356-71604378 AAGACAGAAACACCCTGCTGCGG - Intronic
932605957 2:73165894-73165916 AAGGAACAAGGACCCTGCTGTGG + Intergenic
933926468 2:87094556-87094578 AAGGAACAAGGACCCTGCTGTGG - Intergenic
934525028 2:95046448-95046470 AGTGCAGAAAGTCCCCGCTGGGG + Intronic
936047416 2:109198168-109198190 GTTCCAGAAGGTCCCTGCTGTGG - Intronic
937279948 2:120710956-120710978 CACGCAGCAGGTCCCTGCTGAGG + Intergenic
937326833 2:120994526-120994548 AAGGAAGAAGGCCCCAGCGGTGG - Intergenic
937655868 2:124375378-124375400 AAGGCAAAATGTCACTTCTGTGG + Intronic
938841991 2:135173052-135173074 CAGGCCCAAGGTCCCTCCTGAGG - Intronic
940612223 2:156006460-156006482 AAGGGGGCAGGTCCCTGGTGAGG - Intergenic
940811279 2:158245399-158245421 AAGGCTGAAGGTCACAGCAGAGG + Intronic
941112334 2:161428312-161428334 CAGGCCGCAGGTCCCAGCTGGGG + Intronic
942828533 2:180210263-180210285 AAGACAGAAGGTGCTTGTTGGGG + Intergenic
943647257 2:190419487-190419509 AAGGAAGAGTGTCCCTTCTGTGG + Intronic
945732924 2:213563046-213563068 AATACAGAAGGTCACTGCTATGG - Intronic
947623889 2:231607525-231607547 AAGGCAGAAGTTCCCTCCTCTGG - Intergenic
947949872 2:234137854-234137876 AACCCAGAACGTCCCAGCTGGGG - Intergenic
948069939 2:235112595-235112617 AAGACAGAAGTTCCCTGAAGAGG + Intergenic
948749781 2:240124955-240124977 CAGGCAGAGCGTCCCTACTGTGG - Intergenic
948749811 2:240125066-240125088 CAGGCAGAGTGTCCCTACTGTGG - Intergenic
948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG + Exonic
1169676339 20:8159133-8159155 CAGGCAGAAGCTTGCTGCTGGGG - Intronic
1170043892 20:12065679-12065701 AAGGGAGTAGGTCCCTGATGAGG - Intergenic
1171443715 20:25187808-25187830 AAGGCAGGAGGCCTCTGATGTGG + Intergenic
1171459808 20:25292164-25292186 GAGGCAGAAGGTCCAAGATGGGG - Intronic
1171750535 20:29044516-29044538 CAGGCACAACCTCCCTGCTGTGG - Intergenic
1172903346 20:38350739-38350761 GAGGCGCAAGGTCCCTGGTGAGG + Intronic
1173867074 20:46319109-46319131 AACGCAGGAGGTCCGTGCTCTGG - Intergenic
1175365192 20:58448972-58448994 ATTACAGAAGGGCCCTGCTGAGG + Exonic
1176314681 21:5231431-5231453 CAGGCACAACCTCCCTGCTGCGG + Intergenic
1176848325 21:13893744-13893766 CAGGCAGAAGCTTCCTGCAGAGG + Intergenic
1177258216 21:18693106-18693128 CAGGCAGAAGTTCACTGCAGGGG - Intergenic
1177473095 21:21584143-21584165 CAGGCAGAAGGTTGCTGCAGGGG + Intergenic
1177476773 21:21633799-21633821 CAGGCAGAAGTTTCCTGCAGGGG - Intergenic
1177574845 21:22939308-22939330 AATGCAGCAGGTTTCTGCTGTGG + Intergenic
1178775957 21:35550883-35550905 CAGGCCGAACCTCCCTGCTGTGG - Intronic
1179241713 21:39598643-39598665 ATGGCAGATGGTCCATGCTGTGG - Intronic
1179255719 21:39713581-39713603 AGGGCAGCAGGTCCAGGCTGAGG - Intergenic
1180010919 21:45050665-45050687 AAAGCAGAATGTCCCTGAGGAGG - Intergenic
1180392470 22:12297389-12297411 GAGGCACAACTTCCCTGCTGAGG + Intergenic
1180407278 22:12567379-12567401 GAGGCACAACCTCCCTGCTGAGG - Intergenic
1180821527 22:18832274-18832296 AGGGCAGCAGGTGCCTGCTTTGG + Intergenic
1180971812 22:19819871-19819893 AACGCAGAAGCACACTGCTGTGG + Intronic
1181121237 22:20669646-20669668 ATTGCAGGCGGTCCCTGCTGTGG - Intergenic
1181191451 22:21143771-21143793 AGGGCAGCAGGTGCCTGCTTTGG - Intergenic
1181207747 22:21266739-21266761 AGGGCAGCAGGTGCCTGCTTTGG + Intergenic
1181481337 22:23201096-23201118 AGGGCAGCAGGTCCCTACTCTGG + Intronic
1183092190 22:35530091-35530113 AAGGCGTAAAGTCCCTGCTTAGG + Intergenic
1184676528 22:46046001-46046023 CTGACAGATGGTCCCTGCTGTGG - Intergenic
1185316110 22:50179754-50179776 AGGGCATCAGGTCCCTGCAGGGG - Exonic
1203219173 22_KI270731v1_random:28677-28699 AGGGCAGCAGGTGCCTGCTTTGG - Intergenic
1203271652 22_KI270734v1_random:58150-58172 AGGGCAGCAGGTGCCTGCTTTGG + Intergenic
949902426 3:8827979-8828001 AGTGCAGATGGTCCCTGATGTGG + Intronic
950140363 3:10611114-10611136 CAGGCAGACGGTGCCTCCTGAGG - Intronic
950497052 3:13340113-13340135 AAGGCAGAAGCTGCCTGCACTGG - Intronic
950520439 3:13494842-13494864 AAGCCATGAGGCCCCTGCTGGGG + Intronic
951745754 3:25975376-25975398 GAGGCAGCAGGTCCCTGCTGTGG - Intergenic
952561947 3:34604965-34604987 AAGGCAGAAGGTACATAGTGGGG - Intergenic
952902024 3:38116968-38116990 ATGCCAGGTGGTCCCTGCTGGGG + Exonic
953178317 3:40572705-40572727 AAGGCAGAAGTTCTTTCCTGAGG + Intronic
954195156 3:48991942-48991964 AAGGCAGAGGGTCCTGGTTGGGG + Intronic
954661805 3:52230470-52230492 AGGGCAGAAGGACCCTGCCTAGG + Intronic
955063264 3:55512930-55512952 AATGCAGATGATCCCTTCTGGGG + Intronic
955567237 3:60260320-60260342 AAGACAGAAGTTTCCTGCAGTGG - Intronic
955938671 3:64127611-64127633 AAGGCTTAAGGTCTCAGCTGGGG + Intronic
957300922 3:78390390-78390412 CAGGCAGAAGTTCACTGCAGGGG + Intergenic
958636217 3:96750439-96750461 AAGGGGGAGGGTCCCTGGTGAGG + Intergenic
958956459 3:100469928-100469950 CAGGCAGAAGCTTGCTGCTGGGG - Intergenic
959538782 3:107517056-107517078 ACAGCAGAAGTTCCTTGCTGGGG + Intergenic
959742554 3:109737408-109737430 AAGGCAGAAGTTCGCTGCAGGGG - Intergenic
960774402 3:121232477-121232499 AAGTCAGCAGGGCCATGCTGGGG + Intronic
961370162 3:126423893-126423915 AGGGCAGAAGGTCCTTGGAGAGG - Intronic
962067008 3:131992023-131992045 TAGGCAGAAGTTTCCTGCAGGGG + Intronic
963475154 3:145794772-145794794 AAGGCAGAAGTTTGCTGCAGGGG - Intergenic
964088537 3:152846964-152846986 CAGGCAGAAGGTTGCTGCAGGGG + Intergenic
965065399 3:163841213-163841235 AAGGCAGAAGTTTGCTGCAGGGG - Intergenic
965247022 3:166285946-166285968 AAGCTAGAAAGACCCTGCTGTGG + Intergenic
966074399 3:175919341-175919363 AAGGCAGAAGTTTGCTGCAGGGG - Intergenic
968818338 4:2833104-2833126 AGGGCAGAATCTCCCTGATGAGG + Intronic
969238650 4:5885661-5885683 AAGGCTGAGTGTCCCTGCTGGGG + Intronic
969507851 4:7599221-7599243 AGGGCAGAAGGGGCCTTCTGGGG - Intronic
970061531 4:12039469-12039491 CAGGCAGAAGTTTGCTGCTGGGG + Intergenic
970595022 4:17592208-17592230 AAGGCAGAAGGGAACTTCTGGGG - Intronic
970842711 4:20494154-20494176 AAGGCAGAAGGCCTCTTCGGAGG + Intronic
971938843 4:33188881-33188903 AAGGGGGCAGGTCCCTGCTGAGG - Intergenic
972823005 4:42723816-42723838 AAGCCAAAATGTCCCAGCTGAGG + Intergenic
976461181 4:85314495-85314517 CAGGCAGAAGTTTCCTGCAGGGG - Intergenic
977808125 4:101326882-101326904 AAAGCAAAAGATCCCTTCTGGGG + Intronic
978683795 4:111415173-111415195 AAGGCAGGACTTCCCTACTGGGG - Intergenic
980209918 4:129773524-129773546 GAGGAAGTAGGTCCCTGTTGTGG - Intergenic
980701928 4:136442565-136442587 AAGGGTGCAGGTCCCTGGTGAGG + Intergenic
980744949 4:137001076-137001098 AAAGGGGAAGGTCCCTGGTGAGG + Intergenic
980828186 4:138096953-138096975 AAGTCAGATGGTCCCATCTGGGG - Intergenic
982832932 4:160086343-160086365 AAGGCAGAAGTTTGCTGCAGGGG - Intergenic
982923421 4:161304845-161304867 CAGGCAGAAGGTTGCTGCAGGGG + Intergenic
983083393 4:163414771-163414793 CAGTCAGAAGTTCCCTGCAGGGG + Intergenic
983111694 4:163758207-163758229 AAGGCAGAAGGCCCCAGCTGGGG + Intronic
983301629 4:165933574-165933596 GAGGCAGAAGGTACCTGATATGG - Intronic
983320646 4:166191904-166191926 CAGGCAGAAGTTTCCTGCAGGGG + Intergenic
984294755 4:177840223-177840245 AAGGCAGGATGAACCTGCTGTGG + Intronic
984616144 4:181900756-181900778 AAGGGAGCAGGTCTCTCCTGTGG - Intergenic
986123339 5:4863466-4863488 ATGGCAGCAGGTTCCTTCTGAGG - Intergenic
986190289 5:5490867-5490889 CAGGAGGAATGTCCCTGCTGGGG + Intergenic
986246534 5:6012152-6012174 CAGGCAGAAGTTTGCTGCTGGGG - Intergenic
986344134 5:6818700-6818722 AAGGCAGCAGGTGTTTGCTGTGG + Intergenic
990535330 5:56716046-56716068 AAGGCAGGAGGAACCTGCTTGGG - Intergenic
990923502 5:60993967-60993989 AAGGGAGCAGGTCCCCACTGAGG - Intronic
991586887 5:68210857-68210879 AAGGCAGAAGTTTGCTGCAGGGG - Intergenic
993187081 5:84635243-84635265 AAGGGAGAGGGTCCCCGGTGAGG - Intergenic
994524213 5:100882901-100882923 TAGGCAGAAGTTCGCTGCAGGGG + Intronic
994851229 5:105057332-105057354 AAGGGAGTGGGTCCCTGGTGAGG + Intergenic
995390998 5:111640093-111640115 CAGGCAGAAGGTTGCTGCAGGGG + Intergenic
997200025 5:132004302-132004324 AGGGCACAAGGTCTGTGCTGTGG - Intronic
997424203 5:133792126-133792148 AAGGCAGCATGTTCCTTCTGGGG - Intergenic
999119468 5:149198145-149198167 TAAGCAGAAGGTCCTCGCTGGGG - Intronic
1001152475 5:169244297-169244319 CGGGCAGAAGCTCCCTCCTGAGG - Intronic
1001266152 5:170275993-170276015 AGAGCAGAGGGTCCCTGCAGAGG - Intronic
1001841079 5:174877258-174877280 CAGTCAGGAGGTCCCTGCGGTGG + Intergenic
1003249740 6:4415749-4415771 AAGGTAGAAAGTTCATGCTGGGG - Intergenic
1005692862 6:28323917-28323939 CAGGAACAAGGTCCCAGCTGAGG - Intergenic
1005864738 6:29928812-29928834 ACAGGGGAAGGTCCCTGCTGAGG + Intergenic
1005876550 6:30014383-30014405 AAGGGAGAAGGTCCCTTCAGGGG - Intergenic
1006797542 6:36741315-36741337 AAGGTAGAAGGGCCTTGCTTGGG + Exonic
1006981864 6:38153825-38153847 AGGGCAGGAGGCCCCTGCGGAGG + Exonic
1007270177 6:40630384-40630406 AAGGCAGGAGGTGCAGGCTGGGG + Intergenic
1007281956 6:40719486-40719508 GAGGCAGAAGGGCCTTGGTGGGG - Intergenic
1009610179 6:65931110-65931132 AAGGGAGCAGGTCCCTGGCGAGG - Intergenic
1009757328 6:67956526-67956548 CAGGCAGAAGTTTCCTGCAGTGG + Intergenic
1010882959 6:81201938-81201960 CAGGCAGAAGTTTCCTGCAGGGG + Intergenic
1011786016 6:90845873-90845895 AAGTCAGAAGCTGTCTGCTGCGG - Intergenic
1011795548 6:90947945-90947967 AAGGGAGTGGGTCCCTGGTGAGG + Intergenic
1012089667 6:94875246-94875268 AAGGAAAAAGGAGCCTGCTGAGG - Intergenic
1012582097 6:100881480-100881502 GAGGCGGAAGGTCCCGGCGGCGG + Intergenic
1012731927 6:102894108-102894130 AAGCCAGAGGTTCCCTGCTCAGG + Intergenic
1013337814 6:109182777-109182799 AAGGCAGAATGTCCGTCCTTTGG + Intergenic
1014289263 6:119539637-119539659 AAGGGGGCAGGTCCCTGTTGAGG + Intergenic
1014550058 6:122779692-122779714 AAGGCAGGAGCTGCTTGCTGAGG + Exonic
1016611949 6:145999750-145999772 AAGGCAGAAGTTTGCTGCAGGGG - Intergenic
1017930345 6:158948217-158948239 AAGGAAGAATGACCCGGCTGAGG + Intergenic
1017989153 6:159471145-159471167 CAGGCAGAAGCTTCCTGCAGGGG - Intergenic
1019340005 7:504474-504496 AAGGAACTCGGTCCCTGCTGAGG - Intronic
1021228888 7:18061462-18061484 AATGCAGACAGTCCCTTCTGGGG + Intergenic
1021824869 7:24539761-24539783 ATGGGAGAAGGTCCCAGCAGAGG - Intergenic
1023566450 7:41528019-41528041 AAGGGAGAAGGTCCCTGCTAAGG + Intergenic
1023663325 7:42493540-42493562 CCAGCAGTAGGTCCCTGCTGGGG - Intergenic
1025861822 7:65337656-65337678 TAGGCAGAAGTTCACTGCAGAGG + Intergenic
1026195397 7:68168956-68168978 AAGGCATATGGTCGTTGCTGGGG - Intergenic
1026990199 7:74580765-74580787 TGGGCAGGAGGTCGCTGCTGCGG + Intronic
1027392364 7:77717725-77717747 AAGGGACAAGGTCCCGGGTGTGG + Intronic
1028835343 7:95368488-95368510 AAGACTGAAGGTCCGTGTTGGGG - Intronic
1031477940 7:122245377-122245399 AAAGCTGATGGTACCTGCTGAGG - Intergenic
1031573119 7:123383545-123383567 AAGGCAGAAGTTTGCTGTTGGGG + Intergenic
1033224996 7:139554399-139554421 CAGGCAGAAGTTTGCTGCTGTGG + Intergenic
1034978063 7:155459285-155459307 AAGAAAGAAGGTCCCTTCTGCGG - Intronic
1035784954 8:2253026-2253048 AAAGGGGAAGGTCCCTGCTGGGG - Intergenic
1035807858 8:2468695-2468717 AAAGGGGAAGGTCCCTGCTGGGG + Intergenic
1036696125 8:10976299-10976321 AAGGAAGGAGGACCCTGCTGGGG - Intronic
1036703853 8:11031954-11031976 TAGGCAGAGGCTGCCTGCTGGGG - Intronic
1037506273 8:19532692-19532714 ATGGCAGAAGGTGCCTGAAGAGG + Intronic
1037760302 8:21737596-21737618 AGGGCTGAAGGTGCCGGCTGAGG - Intronic
1039850785 8:41363288-41363310 CATGCACAGGGTCCCTGCTGTGG + Intergenic
1040973461 8:53163558-53163580 AAGTCTGAAGCTGCCTGCTGTGG - Intergenic
1045422142 8:102026801-102026823 CAGGCAGAAGTTTACTGCTGGGG - Intronic
1046967648 8:120185257-120185279 AACACAGATGGTCACTGCTGTGG - Intronic
1049573265 8:143379306-143379328 GAGGCTGAAGGCCCCTGCGGAGG - Exonic
1050938658 9:11430068-11430090 AAGTGAGAAAGTCCCTGTTGTGG + Intergenic
1053721577 9:40952023-40952045 CAGGCAGGATCTCCCTGCTGCGG - Intergenic
1054881340 9:70148049-70148071 AAGCCAAAGGGTCCCTGCAGAGG - Intronic
1057592162 9:96382042-96382064 ACAGCACAAGGTCCCTGCTCTGG - Intronic
1058732874 9:107867458-107867480 AAGGAAGAAGGTCAGTGCAGAGG + Intergenic
1060185705 9:121562904-121562926 AAGCCAGTGGGTCACTGCTGTGG - Intergenic
1060188822 9:121579542-121579564 AAGGCAGAAGGTCCAGGTAGGGG - Intronic
1061383724 9:130276091-130276113 AGGGCAGGAGGTCCCTGGAGGGG + Intergenic
1061594627 9:131620966-131620988 AAGCCTGGAGCTCCCTGCTGGGG + Intronic
1061964452 9:134005124-134005146 AAGCCAGCAGGTCCCTCCTGGGG - Intergenic
1185784341 X:2877250-2877272 AAGCCAGGAACTCCCTGCTGAGG + Exonic
1186410805 X:9342912-9342934 ACGGCAGAGGGGTCCTGCTGCGG + Intergenic
1186797641 X:13062257-13062279 AAGGCAGAAGTTTGCTGCAGGGG - Intergenic
1186935948 X:14450188-14450210 ATGGCACAAGGGCCCTGCTTGGG + Intergenic
1187042669 X:15613358-15613380 AAGGTAGAAGGACCCGGGTGAGG + Intergenic
1187573552 X:20530523-20530545 AATGCAGCAGTTCCCTGCTCTGG + Intergenic
1187598412 X:20800264-20800286 CAGGCAGAAGTTTGCTGCTGGGG + Intergenic
1188614355 X:32139123-32139145 AAGGCAGATGTCCCCTGTTGGGG + Intronic
1189350096 X:40269605-40269627 AAGGGAGTATGTCCCAGCTGTGG + Intergenic
1189637188 X:43023544-43023566 AAGGCAGAAGTTTGCTGCAGGGG - Intergenic
1192185006 X:68940787-68940809 CAGGCAGCAGCTGCCTGCTGTGG - Intergenic
1192750681 X:73987371-73987393 AAAGCAGGAGCTCCCTGATGAGG - Intergenic
1193108479 X:77704504-77704526 AAGGTGGCAGGTCCCTGGTGAGG - Intronic
1193236204 X:79110889-79110911 AAGGGAGAAGTTCTCAGCTGTGG + Intergenic
1194300601 X:92181840-92181862 AAGGCAGAAGTTTGCTGCAGGGG + Intronic
1194662126 X:96639236-96639258 CAGGCAGAAGTTTCCTGCAGGGG + Intergenic
1195128363 X:101830961-101830983 AGGGAAGAAGGTCCAGGCTGTGG + Intergenic
1195479863 X:105332082-105332104 ATAGCAGAAGGTTCCTGTTGGGG + Intronic
1195479885 X:105332276-105332298 ATAGCAGAAGGTCCCTGTTGGGG - Intronic
1196106013 X:111896193-111896215 AAGGCAGAAGGACTCTCCTGAGG - Intronic
1196456392 X:115894352-115894374 AAGGGAGAAGTTCCCGCCTGTGG - Intergenic
1199240781 X:145545231-145545253 AAGGCAGAAGTTTGCTGCAGGGG - Intergenic
1199444702 X:147908983-147909005 AAGACAGAATGACCCTGTTGAGG - Intergenic
1199515255 X:148668477-148668499 CAGGCAGAAGTTCACTGCAGAGG - Intronic
1199818047 X:151417585-151417607 AAGGCAGAAGTAGCTTGCTGAGG + Intergenic
1200125985 X:153815266-153815288 CAGGCAGAGGGGCCCTGCTAAGG - Intronic
1200246565 X:154529704-154529726 GAGGCAGGAGGTCCCAGGTGAGG - Intergenic
1202258848 Y:22948461-22948483 AAGCCAGATGGTCCTTTCTGGGG + Intergenic
1202411836 Y:24582219-24582241 AAGCCAGATGGTCCTTTCTGGGG + Intergenic
1202458946 Y:25087853-25087875 AAGCCAGATGGTCCTTTCTGGGG - Intergenic