ID: 1104743307

View in Genome Browser
Species Human (GRCh38)
Location 12:131194416-131194438
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104743300_1104743307 0 Left 1104743300 12:131194393-131194415 CCATGTGTGGGCGCAGGAGCTAG No data
Right 1104743307 12:131194416-131194438 AAAGGCCTGGTGGATTCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104743307 Original CRISPR AAAGGCCTGGTGGATTCAGG GGG Intergenic
No off target data available for this crispr