ID: 1104748093

View in Genome Browser
Species Human (GRCh38)
Location 12:131222328-131222350
Sequence TGGTAAGCCCCGGCCTCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104748083_1104748093 18 Left 1104748083 12:131222287-131222309 CCAGCTGTGAGCTAAAAAGATCC No data
Right 1104748093 12:131222328-131222350 TGGTAAGCCCCGGCCTCCCGTGG No data
1104748088_1104748093 -4 Left 1104748088 12:131222309-131222331 CCGGAAACCCACCGGTGACTGGT No data
Right 1104748093 12:131222328-131222350 TGGTAAGCCCCGGCCTCCCGTGG No data
1104748086_1104748093 -3 Left 1104748086 12:131222308-131222330 CCCGGAAACCCACCGGTGACTGG No data
Right 1104748093 12:131222328-131222350 TGGTAAGCCCCGGCCTCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104748093 Original CRISPR TGGTAAGCCCCGGCCTCCCG TGG Intergenic
No off target data available for this crispr