ID: 1104750662

View in Genome Browser
Species Human (GRCh38)
Location 12:131236114-131236136
Sequence AGTCCTGGTGGTCCTCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104750662_1104750673 27 Left 1104750662 12:131236114-131236136 CCTCACTGAGGACCACCAGGACT No data
Right 1104750673 12:131236164-131236186 GTCCGGGCGTCCCTCCCACAAGG No data
1104750662_1104750671 10 Left 1104750662 12:131236114-131236136 CCTCACTGAGGACCACCAGGACT No data
Right 1104750671 12:131236147-131236169 CCGATGCTAGCTGGGATGTCCGG No data
1104750662_1104750667 2 Left 1104750662 12:131236114-131236136 CCTCACTGAGGACCACCAGGACT No data
Right 1104750667 12:131236139-131236161 CCCCGACACCGATGCTAGCTGGG No data
1104750662_1104750672 11 Left 1104750662 12:131236114-131236136 CCTCACTGAGGACCACCAGGACT No data
Right 1104750672 12:131236148-131236170 CGATGCTAGCTGGGATGTCCGGG No data
1104750662_1104750665 1 Left 1104750662 12:131236114-131236136 CCTCACTGAGGACCACCAGGACT No data
Right 1104750665 12:131236138-131236160 TCCCCGACACCGATGCTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104750662 Original CRISPR AGTCCTGGTGGTCCTCAGTG AGG (reversed) Intergenic
No off target data available for this crispr