ID: 1104751520

View in Genome Browser
Species Human (GRCh38)
Location 12:131243011-131243033
Sequence CACTTGCCCCTGAAGGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104751520_1104751524 -7 Left 1104751520 12:131243011-131243033 CCACTCTCCTTCAGGGGCAAGTG No data
Right 1104751524 12:131243027-131243049 GCAAGTGGAGAGAAAGAAGAGGG No data
1104751520_1104751527 5 Left 1104751520 12:131243011-131243033 CCACTCTCCTTCAGGGGCAAGTG No data
Right 1104751527 12:131243039-131243061 AAAGAAGAGGGCAGGCTTTAGGG No data
1104751520_1104751523 -8 Left 1104751520 12:131243011-131243033 CCACTCTCCTTCAGGGGCAAGTG No data
Right 1104751523 12:131243026-131243048 GGCAAGTGGAGAGAAAGAAGAGG No data
1104751520_1104751525 -3 Left 1104751520 12:131243011-131243033 CCACTCTCCTTCAGGGGCAAGTG No data
Right 1104751525 12:131243031-131243053 GTGGAGAGAAAGAAGAGGGCAGG No data
1104751520_1104751528 6 Left 1104751520 12:131243011-131243033 CCACTCTCCTTCAGGGGCAAGTG No data
Right 1104751528 12:131243040-131243062 AAGAAGAGGGCAGGCTTTAGGGG No data
1104751520_1104751526 4 Left 1104751520 12:131243011-131243033 CCACTCTCCTTCAGGGGCAAGTG No data
Right 1104751526 12:131243038-131243060 GAAAGAAGAGGGCAGGCTTTAGG No data
1104751520_1104751529 16 Left 1104751520 12:131243011-131243033 CCACTCTCCTTCAGGGGCAAGTG No data
Right 1104751529 12:131243050-131243072 CAGGCTTTAGGGGCATGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104751520 Original CRISPR CACTTGCCCCTGAAGGAGAG TGG (reversed) Intergenic
No off target data available for this crispr