ID: 1104755581

View in Genome Browser
Species Human (GRCh38)
Location 12:131267211-131267233
Sequence CCGTGGCTTTCTCCAGCTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104755571_1104755581 19 Left 1104755571 12:131267169-131267191 CCTTTTTCTGAAAACGTCTTTTC No data
Right 1104755581 12:131267211-131267233 CCGTGGCTTTCTCCAGCTTCGGG No data
1104755570_1104755581 23 Left 1104755570 12:131267165-131267187 CCTGCCTTTTTCTGAAAACGTCT No data
Right 1104755581 12:131267211-131267233 CCGTGGCTTTCTCCAGCTTCGGG No data
1104755572_1104755581 -5 Left 1104755572 12:131267193-131267215 CCTCTCTCCTCTCCCGCCCCGTG No data
Right 1104755581 12:131267211-131267233 CCGTGGCTTTCTCCAGCTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104755581 Original CRISPR CCGTGGCTTTCTCCAGCTTC GGG Intergenic
No off target data available for this crispr