ID: 1104756524

View in Genome Browser
Species Human (GRCh38)
Location 12:131273109-131273131
Sequence CCAGGGGGGCCGGTCTCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104756515_1104756524 -3 Left 1104756515 12:131273089-131273111 CCTCAGGTTTTCACATATGCCCA No data
Right 1104756524 12:131273109-131273131 CCAGGGGGGCCGGTCTCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104756524 Original CRISPR CCAGGGGGGCCGGTCTCCGC CGG Intergenic
No off target data available for this crispr