ID: 1104768311

View in Genome Browser
Species Human (GRCh38)
Location 12:131344996-131345018
Sequence GCTGCTGGTCACTCAGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104768306_1104768311 6 Left 1104768306 12:131344967-131344989 CCATCTGATCTGGCACTGCTGCT No data
Right 1104768311 12:131344996-131345018 GCTGCTGGTCACTCAGCTCCTGG No data
1104768305_1104768311 10 Left 1104768305 12:131344963-131344985 CCTGCCATCTGATCTGGCACTGC No data
Right 1104768311 12:131344996-131345018 GCTGCTGGTCACTCAGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104768311 Original CRISPR GCTGCTGGTCACTCAGCTCC TGG Intergenic
No off target data available for this crispr