ID: 1104768966

View in Genome Browser
Species Human (GRCh38)
Location 12:131348458-131348480
Sequence GACCTGCACTGAAATGCATC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104768959_1104768966 21 Left 1104768959 12:131348414-131348436 CCTCCTCGTCTCCTCCTCAGCCA No data
Right 1104768966 12:131348458-131348480 GACCTGCACTGAAATGCATCGGG No data
1104768960_1104768966 18 Left 1104768960 12:131348417-131348439 CCTCGTCTCCTCCTCAGCCACGC No data
Right 1104768966 12:131348458-131348480 GACCTGCACTGAAATGCATCGGG No data
1104768964_1104768966 1 Left 1104768964 12:131348434-131348456 CCACGCAGCTGGTGCAGCACAGC No data
Right 1104768966 12:131348458-131348480 GACCTGCACTGAAATGCATCGGG No data
1104768963_1104768966 7 Left 1104768963 12:131348428-131348450 CCTCAGCCACGCAGCTGGTGCAG No data
Right 1104768966 12:131348458-131348480 GACCTGCACTGAAATGCATCGGG No data
1104768958_1104768966 24 Left 1104768958 12:131348411-131348433 CCTCCTCCTCGTCTCCTCCTCAG No data
Right 1104768966 12:131348458-131348480 GACCTGCACTGAAATGCATCGGG No data
1104768962_1104768966 10 Left 1104768962 12:131348425-131348447 CCTCCTCAGCCACGCAGCTGGTG No data
Right 1104768966 12:131348458-131348480 GACCTGCACTGAAATGCATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104768966 Original CRISPR GACCTGCACTGAAATGCATC GGG Intergenic
No off target data available for this crispr