ID: 1104771402

View in Genome Browser
Species Human (GRCh38)
Location 12:131366860-131366882
Sequence CGGGGCACTCCACAGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104771393_1104771402 6 Left 1104771393 12:131366831-131366853 CCATGCTGCTGGGTCCCAGGGAG 0: 1
1: 2
2: 5
3: 93
4: 1167
Right 1104771402 12:131366860-131366882 CGGGGCACTCCACAGAAGCTGGG No data
1104771398_1104771402 -8 Left 1104771398 12:131366845-131366867 CCCAGGGAGGCCATGCGGGGCAC 0: 1
1: 0
2: 10
3: 23
4: 184
Right 1104771402 12:131366860-131366882 CGGGGCACTCCACAGAAGCTGGG No data
1104771388_1104771402 26 Left 1104771388 12:131366811-131366833 CCTGAGGAGCAGGGCAGGAGCCA 0: 1
1: 0
2: 5
3: 57
4: 516
Right 1104771402 12:131366860-131366882 CGGGGCACTCCACAGAAGCTGGG No data
1104771399_1104771402 -9 Left 1104771399 12:131366846-131366868 CCAGGGAGGCCATGCGGGGCACT 0: 1
1: 9
2: 0
3: 24
4: 183
Right 1104771402 12:131366860-131366882 CGGGGCACTCCACAGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104771402 Original CRISPR CGGGGCACTCCACAGAAGCT GGG Intergenic