ID: 1104771480

View in Genome Browser
Species Human (GRCh38)
Location 12:131367130-131367152
Sequence CGGGGCACTCCACAGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104771470_1104771480 8 Left 1104771470 12:131367099-131367121 CCTGGAGACTGGGGGTCCCCGTG No data
Right 1104771480 12:131367130-131367152 CGGGGCACTCCACAGAAGCTGGG No data
1104771476_1104771480 -9 Left 1104771476 12:131367116-131367138 CCCGTGAGGCCATGCGGGGCACT No data
Right 1104771480 12:131367130-131367152 CGGGGCACTCCACAGAAGCTGGG No data
1104771475_1104771480 -8 Left 1104771475 12:131367115-131367137 CCCCGTGAGGCCATGCGGGGCAC No data
Right 1104771480 12:131367130-131367152 CGGGGCACTCCACAGAAGCTGGG No data
1104771477_1104771480 -10 Left 1104771477 12:131367117-131367139 CCGTGAGGCCATGCGGGGCACTC No data
Right 1104771480 12:131367130-131367152 CGGGGCACTCCACAGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104771480 Original CRISPR CGGGGCACTCCACAGAAGCT GGG Intergenic