ID: 1104771497

View in Genome Browser
Species Human (GRCh38)
Location 12:131367184-131367206
Sequence CGGGGCACTCCACAGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104771492_1104771497 -8 Left 1104771492 12:131367169-131367191 CCCCGTGAGGCCATGCGGGGCAC No data
Right 1104771497 12:131367184-131367206 CGGGGCACTCCACAGAAGCTGGG No data
1104771482_1104771497 22 Left 1104771482 12:131367139-131367161 CCACAGAAGCTGGGCCTGGAGAC No data
Right 1104771497 12:131367184-131367206 CGGGGCACTCCACAGAAGCTGGG No data
1104771494_1104771497 -10 Left 1104771494 12:131367171-131367193 CCGTGAGGCCATGCGGGGCACTC No data
Right 1104771497 12:131367184-131367206 CGGGGCACTCCACAGAAGCTGGG No data
1104771493_1104771497 -9 Left 1104771493 12:131367170-131367192 CCCGTGAGGCCATGCGGGGCACT No data
Right 1104771497 12:131367184-131367206 CGGGGCACTCCACAGAAGCTGGG No data
1104771487_1104771497 8 Left 1104771487 12:131367153-131367175 CCTGGAGACTGGGGGTCCCCGTG No data
Right 1104771497 12:131367184-131367206 CGGGGCACTCCACAGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104771497 Original CRISPR CGGGGCACTCCACAGAAGCT GGG Intergenic