ID: 1104771514

View in Genome Browser
Species Human (GRCh38)
Location 12:131367238-131367260
Sequence CGGGGCACTCCACAGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104771510_1104771514 -9 Left 1104771510 12:131367224-131367246 CCCGTGAGGCCATGCGGGGCACT No data
Right 1104771514 12:131367238-131367260 CGGGGCACTCCACAGAAGCTGGG No data
1104771509_1104771514 -8 Left 1104771509 12:131367223-131367245 CCCCGTGAGGCCATGCGGGGCAC No data
Right 1104771514 12:131367238-131367260 CGGGGCACTCCACAGAAGCTGGG No data
1104771504_1104771514 8 Left 1104771504 12:131367207-131367229 CCTGGAGACTGGGGGTCCCCGTG No data
Right 1104771514 12:131367238-131367260 CGGGGCACTCCACAGAAGCTGGG No data
1104771499_1104771514 22 Left 1104771499 12:131367193-131367215 CCACAGAAGCTGGGCCTGGAGAC No data
Right 1104771514 12:131367238-131367260 CGGGGCACTCCACAGAAGCTGGG No data
1104771511_1104771514 -10 Left 1104771511 12:131367225-131367247 CCGTGAGGCCATGCGGGGCACTC No data
Right 1104771514 12:131367238-131367260 CGGGGCACTCCACAGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104771514 Original CRISPR CGGGGCACTCCACAGAAGCT GGG Intergenic