ID: 1104771530

View in Genome Browser
Species Human (GRCh38)
Location 12:131367292-131367314
Sequence CGGGGCACTCCACAGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104771516_1104771530 22 Left 1104771516 12:131367247-131367269 CCACAGAAGCTGGGTCTGGAGAC No data
Right 1104771530 12:131367292-131367314 CGGGGCACTCCACAGAAGCTGGG No data
1104771525_1104771530 -8 Left 1104771525 12:131367277-131367299 CCCCGTGAGGCCATGCGGGGCAC No data
Right 1104771530 12:131367292-131367314 CGGGGCACTCCACAGAAGCTGGG No data
1104771526_1104771530 -9 Left 1104771526 12:131367278-131367300 CCCGTGAGGCCATGCGGGGCACT No data
Right 1104771530 12:131367292-131367314 CGGGGCACTCCACAGAAGCTGGG No data
1104771527_1104771530 -10 Left 1104771527 12:131367279-131367301 CCGTGAGGCCATGCGGGGCACTC No data
Right 1104771530 12:131367292-131367314 CGGGGCACTCCACAGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104771530 Original CRISPR CGGGGCACTCCACAGAAGCT GGG Intergenic