ID: 1104771562

View in Genome Browser
Species Human (GRCh38)
Location 12:131367400-131367422
Sequence CGGGGCACTCCACAGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104771559_1104771562 -10 Left 1104771559 12:131367387-131367409 CCGTGAGGCCATGCGGGGCACTC No data
Right 1104771562 12:131367400-131367422 CGGGGCACTCCACAGAAGCTGGG No data
1104771558_1104771562 -9 Left 1104771558 12:131367386-131367408 CCCGTGAGGCCATGCGGGGCACT No data
Right 1104771562 12:131367400-131367422 CGGGGCACTCCACAGAAGCTGGG No data
1104771557_1104771562 -8 Left 1104771557 12:131367385-131367407 CCCCGTGAGGCCATGCGGGGCAC No data
Right 1104771562 12:131367400-131367422 CGGGGCACTCCACAGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104771562 Original CRISPR CGGGGCACTCCACAGAAGCT GGG Intergenic