ID: 1104771576

View in Genome Browser
Species Human (GRCh38)
Location 12:131367453-131367475
Sequence CGGGGCACTCCACAGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104771571_1104771576 -8 Left 1104771571 12:131367438-131367460 CCCCGTGAGGCCATGCGGGGCAC No data
Right 1104771576 12:131367453-131367475 CGGGGCACTCCACAGAAGCTGGG No data
1104771564_1104771576 21 Left 1104771564 12:131367409-131367431 CCACAGAAGCTGGGTCTGGAGAT 0: 1
1: 2
2: 5
3: 37
4: 919
Right 1104771576 12:131367453-131367475 CGGGGCACTCCACAGAAGCTGGG No data
1104771572_1104771576 -9 Left 1104771572 12:131367439-131367461 CCCGTGAGGCCATGCGGGGCACT No data
Right 1104771576 12:131367453-131367475 CGGGGCACTCCACAGAAGCTGGG No data
1104771573_1104771576 -10 Left 1104771573 12:131367440-131367462 CCGTGAGGCCATGCGGGGCACTC No data
Right 1104771576 12:131367453-131367475 CGGGGCACTCCACAGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104771576 Original CRISPR CGGGGCACTCCACAGAAGCT GGG Intergenic