ID: 1104772648

View in Genome Browser
Species Human (GRCh38)
Location 12:131373082-131373104
Sequence ATTGATGGGTGGATGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104772648_1104772656 0 Left 1104772648 12:131373082-131373104 CCTCCCTCCATCCACCCATCAAT No data
Right 1104772656 12:131373105-131373127 CCCTCCCTCCATCCTGTGAGTGG No data
1104772648_1104772658 1 Left 1104772648 12:131373082-131373104 CCTCCCTCCATCCACCCATCAAT No data
Right 1104772658 12:131373106-131373128 CCTCCCTCCATCCTGTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104772648 Original CRISPR ATTGATGGGTGGATGGAGGG AGG (reversed) Intergenic