ID: 1104772648 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:131373082-131373104 |
| Sequence | ATTGATGGGTGGATGGAGGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1104772648_1104772656 | 0 | Left | 1104772648 | 12:131373082-131373104 | CCTCCCTCCATCCACCCATCAAT | No data | ||
| Right | 1104772656 | 12:131373105-131373127 | CCCTCCCTCCATCCTGTGAGTGG | No data | ||||
| 1104772648_1104772658 | 1 | Left | 1104772648 | 12:131373082-131373104 | CCTCCCTCCATCCACCCATCAAT | No data | ||
| Right | 1104772658 | 12:131373106-131373128 | CCTCCCTCCATCCTGTGAGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1104772648 | Original CRISPR | ATTGATGGGTGGATGGAGGG AGG (reversed) | Intergenic | ||