ID: 1104772910

View in Genome Browser
Species Human (GRCh38)
Location 12:131375446-131375468
Sequence CACTGTGCCCAGAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104772910_1104772913 4 Left 1104772910 12:131375446-131375468 CCATCTTCCTTCTGGGCACAGTG No data
Right 1104772913 12:131375473-131375495 CACATTTCTCAGCCCACAGTTGG No data
1104772910_1104772918 28 Left 1104772910 12:131375446-131375468 CCATCTTCCTTCTGGGCACAGTG No data
Right 1104772918 12:131375497-131375519 ATGAGAATGTCTCTGGGCAGCGG No data
1104772910_1104772916 21 Left 1104772910 12:131375446-131375468 CCATCTTCCTTCTGGGCACAGTG No data
Right 1104772916 12:131375490-131375512 AGTTGGCATGAGAATGTCTCTGG No data
1104772910_1104772917 22 Left 1104772910 12:131375446-131375468 CCATCTTCCTTCTGGGCACAGTG No data
Right 1104772917 12:131375491-131375513 GTTGGCATGAGAATGTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104772910 Original CRISPR CACTGTGCCCAGAAGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr