ID: 1104775874

View in Genome Browser
Species Human (GRCh38)
Location 12:131389831-131389853
Sequence TTCCATGGGAAGCAGAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104775874_1104775878 -3 Left 1104775874 12:131389831-131389853 CCCTGGCTCTGCTTCCCATGGAA No data
Right 1104775878 12:131389851-131389873 GAAGACCCGCCCTCCTCTGCTGG No data
1104775874_1104775884 23 Left 1104775874 12:131389831-131389853 CCCTGGCTCTGCTTCCCATGGAA No data
Right 1104775884 12:131389877-131389899 CAATTCTGCACCTCTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104775874 Original CRISPR TTCCATGGGAAGCAGAGCCA GGG (reversed) Intergenic
No off target data available for this crispr