ID: 1104781694

View in Genome Browser
Species Human (GRCh38)
Location 12:131425573-131425595
Sequence GTCTCTACCCTCACTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104781694_1104781702 24 Left 1104781694 12:131425573-131425595 CCACACCCAGTGAGGGTAGAGAC No data
Right 1104781702 12:131425620-131425642 TCCAGGCTCTGCAATGGAAGTGG No data
1104781694_1104781701 18 Left 1104781694 12:131425573-131425595 CCACACCCAGTGAGGGTAGAGAC No data
Right 1104781701 12:131425614-131425636 TCTGACTCCAGGCTCTGCAATGG No data
1104781694_1104781699 7 Left 1104781694 12:131425573-131425595 CCACACCCAGTGAGGGTAGAGAC No data
Right 1104781699 12:131425603-131425625 TACCTGAGCTATCTGACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104781694 Original CRISPR GTCTCTACCCTCACTGGGTG TGG (reversed) Intergenic
No off target data available for this crispr