ID: 1104788119

View in Genome Browser
Species Human (GRCh38)
Location 12:131464214-131464236
Sequence CACTGAAGGCAGGCAGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104788113_1104788119 20 Left 1104788113 12:131464171-131464193 CCACAAATGACATTTATTAGTAA No data
Right 1104788119 12:131464214-131464236 CACTGAAGGCAGGCAGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104788119 Original CRISPR CACTGAAGGCAGGCAGGGAG AGG Intergenic
No off target data available for this crispr