ID: 1104789511

View in Genome Browser
Species Human (GRCh38)
Location 12:131472970-131472992
Sequence CCAGTGGAATGGTGGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104789498_1104789511 29 Left 1104789498 12:131472918-131472940 CCATCTAGATGAGGAGACAGGGG No data
Right 1104789511 12:131472970-131472992 CCAGTGGAATGGTGGGAAATGGG No data
1104789503_1104789511 0 Left 1104789503 12:131472947-131472969 CCTCAGAATCAACCAGGAAGGCT No data
Right 1104789511 12:131472970-131472992 CCAGTGGAATGGTGGGAAATGGG No data
1104789496_1104789511 30 Left 1104789496 12:131472917-131472939 CCCATCTAGATGAGGAGACAGGG No data
Right 1104789511 12:131472970-131472992 CCAGTGGAATGGTGGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104789511 Original CRISPR CCAGTGGAATGGTGGGAAAT GGG Intergenic
No off target data available for this crispr