ID: 1104790014

View in Genome Browser
Species Human (GRCh38)
Location 12:131475383-131475405
Sequence CCAGTGCATCTCTGCTGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 2, 1: 0, 2: 2, 3: 21, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104790002_1104790014 15 Left 1104790002 12:131475345-131475367 CCAAGCGTTGTCTCTTCCCTCTC 0: 2
1: 0
2: 1
3: 14
4: 277
Right 1104790014 12:131475383-131475405 CCAGTGCATCTCTGCTGAGGGGG 0: 2
1: 0
2: 2
3: 21
4: 168
1104790004_1104790014 -1 Left 1104790004 12:131475361-131475383 CCCTCTCCCTGGTGAGCCCACGC 0: 2
1: 0
2: 1
3: 23
4: 243
Right 1104790014 12:131475383-131475405 CCAGTGCATCTCTGCTGAGGGGG 0: 2
1: 0
2: 2
3: 21
4: 168
1104790005_1104790014 -2 Left 1104790005 12:131475362-131475384 CCTCTCCCTGGTGAGCCCACGCC 0: 2
1: 0
2: 1
3: 19
4: 231
Right 1104790014 12:131475383-131475405 CCAGTGCATCTCTGCTGAGGGGG 0: 2
1: 0
2: 2
3: 21
4: 168
1104790007_1104790014 -8 Left 1104790007 12:131475368-131475390 CCTGGTGAGCCCACGCCAGTGCA 0: 2
1: 0
2: 0
3: 10
4: 112
Right 1104790014 12:131475383-131475405 CCAGTGCATCTCTGCTGAGGGGG 0: 2
1: 0
2: 2
3: 21
4: 168
1104790006_1104790014 -7 Left 1104790006 12:131475367-131475389 CCCTGGTGAGCCCACGCCAGTGC 0: 2
1: 0
2: 0
3: 8
4: 137
Right 1104790014 12:131475383-131475405 CCAGTGCATCTCTGCTGAGGGGG 0: 2
1: 0
2: 2
3: 21
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104790014 Original CRISPR CCAGTGCATCTCTGCTGAGG GGG Intergenic