ID: 1104791306

View in Genome Browser
Species Human (GRCh38)
Location 12:131483750-131483772
Sequence CAGTAAGTCTGGAGACAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104791302_1104791306 -9 Left 1104791302 12:131483736-131483758 CCCAGGCGAGTGGACAGTAAGTC No data
Right 1104791306 12:131483750-131483772 CAGTAAGTCTGGAGACAAGTGGG No data
1104791303_1104791306 -10 Left 1104791303 12:131483737-131483759 CCAGGCGAGTGGACAGTAAGTCT No data
Right 1104791306 12:131483750-131483772 CAGTAAGTCTGGAGACAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104791306 Original CRISPR CAGTAAGTCTGGAGACAAGT GGG Intergenic
No off target data available for this crispr