ID: 1104792465

View in Genome Browser
Species Human (GRCh38)
Location 12:131492689-131492711
Sequence TGCTGTCCACCCTCAGTGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104792465_1104792472 11 Left 1104792465 12:131492689-131492711 CCCCGCACTGAGGGTGGACAGCA No data
Right 1104792472 12:131492723-131492745 TCTGAGCCTTTTCTCCACTGTGG No data
1104792465_1104792473 12 Left 1104792465 12:131492689-131492711 CCCCGCACTGAGGGTGGACAGCA No data
Right 1104792473 12:131492724-131492746 CTGAGCCTTTTCTCCACTGTGGG No data
1104792465_1104792476 30 Left 1104792465 12:131492689-131492711 CCCCGCACTGAGGGTGGACAGCA No data
Right 1104792476 12:131492742-131492764 GTGGGACAGACTTACAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104792465 Original CRISPR TGCTGTCCACCCTCAGTGCG GGG (reversed) Intergenic
No off target data available for this crispr