ID: 1104794775

View in Genome Browser
Species Human (GRCh38)
Location 12:131509791-131509813
Sequence TGGCATTGGAGTAGAGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104794768_1104794775 28 Left 1104794768 12:131509740-131509762 CCCTACCTGTTGACACAGAGGAT No data
Right 1104794775 12:131509791-131509813 TGGCATTGGAGTAGAGGGCACGG No data
1104794770_1104794775 23 Left 1104794770 12:131509745-131509767 CCTGTTGACACAGAGGATGAAAA No data
Right 1104794775 12:131509791-131509813 TGGCATTGGAGTAGAGGGCACGG No data
1104794769_1104794775 27 Left 1104794769 12:131509741-131509763 CCTACCTGTTGACACAGAGGATG No data
Right 1104794775 12:131509791-131509813 TGGCATTGGAGTAGAGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104794775 Original CRISPR TGGCATTGGAGTAGAGGGCA CGG Intergenic
No off target data available for this crispr