ID: 1104795101

View in Genome Browser
Species Human (GRCh38)
Location 12:131511755-131511777
Sequence GTGAGGGTTGCAGCGACCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104795101_1104795107 12 Left 1104795101 12:131511755-131511777 CCACGGGTCGCTGCAACCCTCAC No data
Right 1104795107 12:131511790-131511812 TATTCCCTAAAGGGCCCTGCAGG No data
1104795101_1104795104 2 Left 1104795101 12:131511755-131511777 CCACGGGTCGCTGCAACCCTCAC No data
Right 1104795104 12:131511780-131511802 TGCACCTCACTATTCCCTAAAGG No data
1104795101_1104795110 17 Left 1104795101 12:131511755-131511777 CCACGGGTCGCTGCAACCCTCAC No data
Right 1104795110 12:131511795-131511817 CCTAAAGGGCCCTGCAGGACTGG No data
1104795101_1104795105 3 Left 1104795101 12:131511755-131511777 CCACGGGTCGCTGCAACCCTCAC No data
Right 1104795105 12:131511781-131511803 GCACCTCACTATTCCCTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104795101 Original CRISPR GTGAGGGTTGCAGCGACCCG TGG (reversed) Intergenic