ID: 1104795102

View in Genome Browser
Species Human (GRCh38)
Location 12:131511771-131511793
Sequence AATAGTGAGGTGCAGTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104795102_1104795110 1 Left 1104795102 12:131511771-131511793 CCCTCACACTGCACCTCACTATT No data
Right 1104795110 12:131511795-131511817 CCTAAAGGGCCCTGCAGGACTGG No data
1104795102_1104795113 18 Left 1104795102 12:131511771-131511793 CCCTCACACTGCACCTCACTATT No data
Right 1104795113 12:131511812-131511834 GACTGGTTCCATCCCTTCTCTGG No data
1104795102_1104795107 -4 Left 1104795102 12:131511771-131511793 CCCTCACACTGCACCTCACTATT No data
Right 1104795107 12:131511790-131511812 TATTCCCTAAAGGGCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104795102 Original CRISPR AATAGTGAGGTGCAGTGTGA GGG (reversed) Intergenic