ID: 1104795103

View in Genome Browser
Species Human (GRCh38)
Location 12:131511772-131511794
Sequence GAATAGTGAGGTGCAGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104795103_1104795107 -5 Left 1104795103 12:131511772-131511794 CCTCACACTGCACCTCACTATTC No data
Right 1104795107 12:131511790-131511812 TATTCCCTAAAGGGCCCTGCAGG No data
1104795103_1104795113 17 Left 1104795103 12:131511772-131511794 CCTCACACTGCACCTCACTATTC No data
Right 1104795113 12:131511812-131511834 GACTGGTTCCATCCCTTCTCTGG No data
1104795103_1104795110 0 Left 1104795103 12:131511772-131511794 CCTCACACTGCACCTCACTATTC No data
Right 1104795110 12:131511795-131511817 CCTAAAGGGCCCTGCAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104795103 Original CRISPR GAATAGTGAGGTGCAGTGTG AGG (reversed) Intergenic