ID: 1104795105

View in Genome Browser
Species Human (GRCh38)
Location 12:131511781-131511803
Sequence GCACCTCACTATTCCCTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104795096_1104795105 23 Left 1104795096 12:131511735-131511757 CCCAGGCTGGGCTGAGCAGCCCA No data
Right 1104795105 12:131511781-131511803 GCACCTCACTATTCCCTAAAGGG No data
1104795101_1104795105 3 Left 1104795101 12:131511755-131511777 CCACGGGTCGCTGCAACCCTCAC No data
Right 1104795105 12:131511781-131511803 GCACCTCACTATTCCCTAAAGGG No data
1104795097_1104795105 22 Left 1104795097 12:131511736-131511758 CCAGGCTGGGCTGAGCAGCCCAC No data
Right 1104795105 12:131511781-131511803 GCACCTCACTATTCCCTAAAGGG No data
1104795095_1104795105 24 Left 1104795095 12:131511734-131511756 CCCCAGGCTGGGCTGAGCAGCCC No data
Right 1104795105 12:131511781-131511803 GCACCTCACTATTCCCTAAAGGG No data
1104795100_1104795105 4 Left 1104795100 12:131511754-131511776 CCCACGGGTCGCTGCAACCCTCA No data
Right 1104795105 12:131511781-131511803 GCACCTCACTATTCCCTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104795105 Original CRISPR GCACCTCACTATTCCCTAAA GGG Intergenic