ID: 1104795110

View in Genome Browser
Species Human (GRCh38)
Location 12:131511795-131511817
Sequence CCTAAAGGGCCCTGCAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104795103_1104795110 0 Left 1104795103 12:131511772-131511794 CCTCACACTGCACCTCACTATTC No data
Right 1104795110 12:131511795-131511817 CCTAAAGGGCCCTGCAGGACTGG No data
1104795101_1104795110 17 Left 1104795101 12:131511755-131511777 CCACGGGTCGCTGCAACCCTCAC No data
Right 1104795110 12:131511795-131511817 CCTAAAGGGCCCTGCAGGACTGG No data
1104795102_1104795110 1 Left 1104795102 12:131511771-131511793 CCCTCACACTGCACCTCACTATT No data
Right 1104795110 12:131511795-131511817 CCTAAAGGGCCCTGCAGGACTGG No data
1104795100_1104795110 18 Left 1104795100 12:131511754-131511776 CCCACGGGTCGCTGCAACCCTCA No data
Right 1104795110 12:131511795-131511817 CCTAAAGGGCCCTGCAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104795110 Original CRISPR CCTAAAGGGCCCTGCAGGAC TGG Intergenic