ID: 1104795113

View in Genome Browser
Species Human (GRCh38)
Location 12:131511812-131511834
Sequence GACTGGTTCCATCCCTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104795103_1104795113 17 Left 1104795103 12:131511772-131511794 CCTCACACTGCACCTCACTATTC No data
Right 1104795113 12:131511812-131511834 GACTGGTTCCATCCCTTCTCTGG No data
1104795108_1104795113 -5 Left 1104795108 12:131511794-131511816 CCCTAAAGGGCCCTGCAGGACTG No data
Right 1104795113 12:131511812-131511834 GACTGGTTCCATCCCTTCTCTGG No data
1104795109_1104795113 -6 Left 1104795109 12:131511795-131511817 CCTAAAGGGCCCTGCAGGACTGG No data
Right 1104795113 12:131511812-131511834 GACTGGTTCCATCCCTTCTCTGG No data
1104795102_1104795113 18 Left 1104795102 12:131511771-131511793 CCCTCACACTGCACCTCACTATT No data
Right 1104795113 12:131511812-131511834 GACTGGTTCCATCCCTTCTCTGG No data
1104795106_1104795113 5 Left 1104795106 12:131511784-131511806 CCTCACTATTCCCTAAAGGGCCC No data
Right 1104795113 12:131511812-131511834 GACTGGTTCCATCCCTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104795113 Original CRISPR GACTGGTTCCATCCCTTCTC TGG Intergenic