ID: 1104797247

View in Genome Browser
Species Human (GRCh38)
Location 12:131528297-131528319
Sequence GAGTAGAACTTCAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104797241_1104797247 -9 Left 1104797241 12:131528283-131528305 CCCCTCGTGTGTCTGAGTAGAAC No data
Right 1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG No data
1104797237_1104797247 19 Left 1104797237 12:131528255-131528277 CCAGGAGATGCCAATGAGCCAGA No data
Right 1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG No data
1104797239_1104797247 9 Left 1104797239 12:131528265-131528287 CCAATGAGCCAGACGTGGCCCCT No data
Right 1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG No data
1104797240_1104797247 1 Left 1104797240 12:131528273-131528295 CCAGACGTGGCCCCTCGTGTGTC No data
Right 1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG No data
1104797236_1104797247 20 Left 1104797236 12:131528254-131528276 CCCAGGAGATGCCAATGAGCCAG No data
Right 1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG No data
1104797242_1104797247 -10 Left 1104797242 12:131528284-131528306 CCCTCGTGTGTCTGAGTAGAACT No data
Right 1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104797247 Original CRISPR GAGTAGAACTTCAGGGAAGA GGG Intergenic
No off target data available for this crispr