ID: 1104800585 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:131552899-131552921 |
Sequence | CAGTGCAATCAGAGTGAGGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 5 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1104800580_1104800585 | -3 | Left | 1104800580 | 12:131552879-131552901 | CCCCAGGGGGCTCGCTGCCTCAG | No data | ||
Right | 1104800585 | 12:131552899-131552921 | CAGTGCAATCAGAGTGAGGCTGG | No data | ||||
1104800578_1104800585 | -1 | Left | 1104800578 | 12:131552877-131552899 | CCCCCCAGGGGGCTCGCTGCCTC | No data | ||
Right | 1104800585 | 12:131552899-131552921 | CAGTGCAATCAGAGTGAGGCTGG | No data | ||||
1104800581_1104800585 | -4 | Left | 1104800581 | 12:131552880-131552902 | CCCAGGGGGCTCGCTGCCTCAGT | No data | ||
Right | 1104800585 | 12:131552899-131552921 | CAGTGCAATCAGAGTGAGGCTGG | No data | ||||
1104800579_1104800585 | -2 | Left | 1104800579 | 12:131552878-131552900 | CCCCCAGGGGGCTCGCTGCCTCA | No data | ||
Right | 1104800585 | 12:131552899-131552921 | CAGTGCAATCAGAGTGAGGCTGG | No data | ||||
1104800582_1104800585 | -5 | Left | 1104800582 | 12:131552881-131552903 | CCAGGGGGCTCGCTGCCTCAGTG | No data | ||
Right | 1104800585 | 12:131552899-131552921 | CAGTGCAATCAGAGTGAGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1104800585 | Original CRISPR | CAGTGCAATCAGAGTGAGGC TGG | Intergenic | ||
No off target data available for this crispr |