ID: 1104800585

View in Genome Browser
Species Human (GRCh38)
Location 12:131552899-131552921
Sequence CAGTGCAATCAGAGTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104800580_1104800585 -3 Left 1104800580 12:131552879-131552901 CCCCAGGGGGCTCGCTGCCTCAG No data
Right 1104800585 12:131552899-131552921 CAGTGCAATCAGAGTGAGGCTGG No data
1104800578_1104800585 -1 Left 1104800578 12:131552877-131552899 CCCCCCAGGGGGCTCGCTGCCTC No data
Right 1104800585 12:131552899-131552921 CAGTGCAATCAGAGTGAGGCTGG No data
1104800581_1104800585 -4 Left 1104800581 12:131552880-131552902 CCCAGGGGGCTCGCTGCCTCAGT No data
Right 1104800585 12:131552899-131552921 CAGTGCAATCAGAGTGAGGCTGG No data
1104800579_1104800585 -2 Left 1104800579 12:131552878-131552900 CCCCCAGGGGGCTCGCTGCCTCA No data
Right 1104800585 12:131552899-131552921 CAGTGCAATCAGAGTGAGGCTGG No data
1104800582_1104800585 -5 Left 1104800582 12:131552881-131552903 CCAGGGGGCTCGCTGCCTCAGTG No data
Right 1104800585 12:131552899-131552921 CAGTGCAATCAGAGTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104800585 Original CRISPR CAGTGCAATCAGAGTGAGGC TGG Intergenic
No off target data available for this crispr