ID: 1104800838

View in Genome Browser
Species Human (GRCh38)
Location 12:131554449-131554471
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104800827_1104800838 11 Left 1104800827 12:131554415-131554437 CCTGAAGGCTTCTCTTGCTACAT No data
Right 1104800838 12:131554449-131554471 CAGTGGCAGCACCGGGGCCCAGG No data
1104800826_1104800838 12 Left 1104800826 12:131554414-131554436 CCCTGAAGGCTTCTCTTGCTACA No data
Right 1104800838 12:131554449-131554471 CAGTGGCAGCACCGGGGCCCAGG No data
1104800825_1104800838 23 Left 1104800825 12:131554403-131554425 CCTCTGTATCACCCTGAAGGCTT No data
Right 1104800838 12:131554449-131554471 CAGTGGCAGCACCGGGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104800838 Original CRISPR CAGTGGCAGCACCGGGGCCC AGG Intergenic