ID: 1104803285

View in Genome Browser
Species Human (GRCh38)
Location 12:131569347-131569369
Sequence CTGAGGAGAGGGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5380
Summary {0: 1, 1: 3, 2: 46, 3: 663, 4: 4667}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104803285_1104803305 30 Left 1104803285 12:131569347-131569369 CCCTCCTCCCTCCCTCTCCTCAG 0: 1
1: 3
2: 46
3: 663
4: 4667
Right 1104803305 12:131569400-131569422 AGCAGCCCCAGGGTCTTTTGGGG 0: 1
1: 0
2: 1
3: 15
4: 207
1104803285_1104803294 -4 Left 1104803285 12:131569347-131569369 CCCTCCTCCCTCCCTCTCCTCAG 0: 1
1: 3
2: 46
3: 663
4: 4667
Right 1104803294 12:131569366-131569388 TCAGGACATAATTCCACCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 106
1104803285_1104803303 28 Left 1104803285 12:131569347-131569369 CCCTCCTCCCTCCCTCTCCTCAG 0: 1
1: 3
2: 46
3: 663
4: 4667
Right 1104803303 12:131569398-131569420 GAAGCAGCCCCAGGGTCTTTTGG 0: 1
1: 0
2: 2
3: 22
4: 173
1104803285_1104803302 20 Left 1104803285 12:131569347-131569369 CCCTCCTCCCTCCCTCTCCTCAG 0: 1
1: 3
2: 46
3: 663
4: 4667
Right 1104803302 12:131569390-131569412 CACTGGAGGAAGCAGCCCCAGGG 0: 1
1: 1
2: 1
3: 28
4: 345
1104803285_1104803296 6 Left 1104803285 12:131569347-131569369 CCCTCCTCCCTCCCTCTCCTCAG 0: 1
1: 3
2: 46
3: 663
4: 4667
Right 1104803296 12:131569376-131569398 ATTCCACCCCAGGTCACTGGAGG 0: 1
1: 0
2: 1
3: 12
4: 132
1104803285_1104803304 29 Left 1104803285 12:131569347-131569369 CCCTCCTCCCTCCCTCTCCTCAG 0: 1
1: 3
2: 46
3: 663
4: 4667
Right 1104803304 12:131569399-131569421 AAGCAGCCCCAGGGTCTTTTGGG 0: 1
1: 0
2: 0
3: 16
4: 188
1104803285_1104803295 3 Left 1104803285 12:131569347-131569369 CCCTCCTCCCTCCCTCTCCTCAG 0: 1
1: 3
2: 46
3: 663
4: 4667
Right 1104803295 12:131569373-131569395 ATAATTCCACCCCAGGTCACTGG 0: 1
1: 0
2: 0
3: 12
4: 81
1104803285_1104803301 19 Left 1104803285 12:131569347-131569369 CCCTCCTCCCTCCCTCTCCTCAG 0: 1
1: 3
2: 46
3: 663
4: 4667
Right 1104803301 12:131569389-131569411 TCACTGGAGGAAGCAGCCCCAGG 0: 1
1: 0
2: 2
3: 26
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104803285 Original CRISPR CTGAGGAGAGGGAGGGAGGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr