ID: 1104808909

View in Genome Browser
Species Human (GRCh38)
Location 12:131608207-131608229
Sequence CGGATTCCAGCAGTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104808901_1104808909 16 Left 1104808901 12:131608168-131608190 CCTTCAAGTTGTTTTCCAGACTT No data
Right 1104808909 12:131608207-131608229 CGGATTCCAGCAGTGGTGGAGGG No data
1104808903_1104808909 1 Left 1104808903 12:131608183-131608205 CCAGACTTTTTTGTGTATAGGCC No data
Right 1104808909 12:131608207-131608229 CGGATTCCAGCAGTGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104808909 Original CRISPR CGGATTCCAGCAGTGGTGGA GGG Intergenic
No off target data available for this crispr