ID: 1104811164

View in Genome Browser
Species Human (GRCh38)
Location 12:131621156-131621178
Sequence ACAAGGGCCCTTGTTGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104811160_1104811164 -6 Left 1104811160 12:131621139-131621161 CCCTGGGGGAGGCGGACACAAGG No data
Right 1104811164 12:131621156-131621178 ACAAGGGCCCTTGTTGTTCCTGG No data
1104811148_1104811164 28 Left 1104811148 12:131621105-131621127 CCAGGCCAGGCTCTGTTCCTCAC No data
Right 1104811164 12:131621156-131621178 ACAAGGGCCCTTGTTGTTCCTGG No data
1104811147_1104811164 29 Left 1104811147 12:131621104-131621126 CCCAGGCCAGGCTCTGTTCCTCA No data
Right 1104811164 12:131621156-131621178 ACAAGGGCCCTTGTTGTTCCTGG No data
1104811162_1104811164 -7 Left 1104811162 12:131621140-131621162 CCTGGGGGAGGCGGACACAAGGG No data
Right 1104811164 12:131621156-131621178 ACAAGGGCCCTTGTTGTTCCTGG No data
1104811151_1104811164 23 Left 1104811151 12:131621110-131621132 CCAGGCTCTGTTCCTCACTGGGG No data
Right 1104811164 12:131621156-131621178 ACAAGGGCCCTTGTTGTTCCTGG No data
1104811153_1104811164 11 Left 1104811153 12:131621122-131621144 CCTCACTGGGGCACTGTCCCTGG No data
Right 1104811164 12:131621156-131621178 ACAAGGGCCCTTGTTGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104811164 Original CRISPR ACAAGGGCCCTTGTTGTTCC TGG Intergenic
No off target data available for this crispr