ID: 1104811299

View in Genome Browser
Species Human (GRCh38)
Location 12:131621883-131621905
Sequence AGTGCAGGAGCTGCGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 429}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104811299_1104811306 12 Left 1104811299 12:131621883-131621905 CCTGCTGCCGCAGCTCCTGCACT 0: 1
1: 0
2: 2
3: 47
4: 429
Right 1104811306 12:131621918-131621940 GCCTGGCCACACTCCCTGCACGG 0: 1
1: 0
2: 4
3: 42
4: 314
1104811299_1104811303 -5 Left 1104811299 12:131621883-131621905 CCTGCTGCCGCAGCTCCTGCACT 0: 1
1: 0
2: 2
3: 47
4: 429
Right 1104811303 12:131621901-131621923 GCACTCCACGGAGCCTCGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 87
1104811299_1104811309 14 Left 1104811299 12:131621883-131621905 CCTGCTGCCGCAGCTCCTGCACT 0: 1
1: 0
2: 2
3: 47
4: 429
Right 1104811309 12:131621920-131621942 CTGGCCACACTCCCTGCACGGGG 0: 1
1: 0
2: 0
3: 30
4: 217
1104811299_1104811308 13 Left 1104811299 12:131621883-131621905 CCTGCTGCCGCAGCTCCTGCACT 0: 1
1: 0
2: 2
3: 47
4: 429
Right 1104811308 12:131621919-131621941 CCTGGCCACACTCCCTGCACGGG 0: 1
1: 0
2: 3
3: 60
4: 433
1104811299_1104811311 23 Left 1104811299 12:131621883-131621905 CCTGCTGCCGCAGCTCCTGCACT 0: 1
1: 0
2: 2
3: 47
4: 429
Right 1104811311 12:131621929-131621951 CTCCCTGCACGGGGCAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104811299 Original CRISPR AGTGCAGGAGCTGCGGCAGC AGG (reversed) Intergenic