ID: 1104811299

View in Genome Browser
Species Human (GRCh38)
Location 12:131621883-131621905
Sequence AGTGCAGGAGCTGCGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 429}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104811299_1104811308 13 Left 1104811299 12:131621883-131621905 CCTGCTGCCGCAGCTCCTGCACT 0: 1
1: 0
2: 2
3: 47
4: 429
Right 1104811308 12:131621919-131621941 CCTGGCCACACTCCCTGCACGGG 0: 1
1: 0
2: 3
3: 60
4: 433
1104811299_1104811303 -5 Left 1104811299 12:131621883-131621905 CCTGCTGCCGCAGCTCCTGCACT 0: 1
1: 0
2: 2
3: 47
4: 429
Right 1104811303 12:131621901-131621923 GCACTCCACGGAGCCTCGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 87
1104811299_1104811306 12 Left 1104811299 12:131621883-131621905 CCTGCTGCCGCAGCTCCTGCACT 0: 1
1: 0
2: 2
3: 47
4: 429
Right 1104811306 12:131621918-131621940 GCCTGGCCACACTCCCTGCACGG 0: 1
1: 0
2: 4
3: 42
4: 314
1104811299_1104811311 23 Left 1104811299 12:131621883-131621905 CCTGCTGCCGCAGCTCCTGCACT 0: 1
1: 0
2: 2
3: 47
4: 429
Right 1104811311 12:131621929-131621951 CTCCCTGCACGGGGCAGCTCAGG No data
1104811299_1104811309 14 Left 1104811299 12:131621883-131621905 CCTGCTGCCGCAGCTCCTGCACT 0: 1
1: 0
2: 2
3: 47
4: 429
Right 1104811309 12:131621920-131621942 CTGGCCACACTCCCTGCACGGGG 0: 1
1: 0
2: 0
3: 30
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104811299 Original CRISPR AGTGCAGGAGCTGCGGCAGC AGG (reversed) Intergenic
900462655 1:2808960-2808982 TGTGGAGGAGCTGGGGCTGCCGG + Intergenic
900870461 1:5298535-5298557 AGGGCAGGCACTGCGGCAGCGGG + Intergenic
902623656 1:17664583-17664605 AGTGCAGTACCTGAGGCTGCAGG - Exonic
904056252 1:27672308-27672330 AGTGCAGGAGCTGGGAGAGAGGG - Intergenic
904434586 1:30485959-30485981 ACTGCAGGAGGTCCGGCTGCAGG + Intergenic
904684110 1:32248403-32248425 AGGGCAGCTGCTGCGGCTGCGGG + Exonic
904824132 1:33263850-33263872 GTTGCAGGAGATGAGGCAGCAGG + Intronic
904991117 1:34593484-34593506 AGAGCAGCAGCAGCAGCAGCAGG + Intergenic
905672204 1:39799205-39799227 AGTGGAGGAGCTGCGACTCCAGG - Intergenic
905674756 1:39817602-39817624 AGTGGAGGAGCTGCGGCTACGGG + Intergenic
906214100 1:44029335-44029357 AGTGGAGGAGCTGTGGGAGCAGG + Intronic
906512592 1:46419187-46419209 AGGGCAGGAGATGAGGCCGCAGG - Intergenic
906808291 1:48801301-48801323 AGTGCAGGAGCTGCAGCCAACGG - Intronic
907551705 1:55310379-55310401 TGTGCTGGAGCTGCAGCAGCTGG + Intergenic
908114219 1:60925105-60925127 GGTGCAGGACCTCAGGCAGCTGG - Intronic
908780678 1:67686491-67686513 AGAGCAGGAGCTCCGCCAGCCGG - Exonic
909741658 1:79037067-79037089 ACTGCAGGAGCTGGAACAGCTGG - Intergenic
911711416 1:101077969-101077991 AGTGCAGGAGGTGAGGAGGCAGG + Intergenic
911999417 1:104812222-104812244 AGTGCAGGAGCTACCACTGCAGG - Intergenic
912488687 1:110049193-110049215 AGTGCTTGAGCAGCAGCAGCAGG - Exonic
912516868 1:110221805-110221827 CGTGCAGGACAGGCGGCAGCAGG + Intronic
913109092 1:115641970-115641992 AGTGCAGCGGCGGCGGCGGCGGG + Exonic
913267502 1:117059765-117059787 AGTGCAGGAGCCGAAGCGGCGGG - Intergenic
915356001 1:155255442-155255464 AGTCCCCGACCTGCGGCAGCCGG - Intronic
915490436 1:156247415-156247437 AGTGGAGGGGCTGGGCCAGCTGG + Intronic
915828295 1:159102137-159102159 ATAGCAGGAGCTGAAGCAGCTGG - Intronic
916120728 1:161525825-161525847 AGTGCAGGATCTCCTGCTGCTGG + Exonic
916130495 1:161607458-161607480 AGTGCAGGATCTCCTGCTGCTGG + Intronic
916583530 1:166129715-166129737 AGTGCAGGAGAAGAAGCAGCAGG - Intronic
917164487 1:172097061-172097083 AGTGCAGGAGAAGGGGGAGCAGG + Intronic
919558266 1:199088355-199088377 ACTCCAGGAGCTGAGGCAGGAGG - Intergenic
919673159 1:200356334-200356356 TATGCAGGAGCTGAGGCAGGAGG - Intergenic
921812361 1:219529418-219529440 AGAGCAGCAGCAGCAGCAGCAGG + Intergenic
922678462 1:227568904-227568926 AGTGCAGGAGCGGCAGCTGGAGG + Intronic
923173931 1:231445343-231445365 AGTGCAGAAGCTGCAGCTGAAGG + Intergenic
924580306 1:245317702-245317724 TGTGCAGGAGCTGGGGGAGAGGG - Intronic
1062921659 10:1284953-1284975 TCTGCAGGAGCTGGGGCATCTGG - Intronic
1064067650 10:12196220-12196242 AAGGCAGCAGCGGCGGCAGCTGG + Exonic
1064126465 10:12665860-12665882 ACTGCAGGCCCTGCGTCAGCAGG - Intronic
1065011690 10:21426934-21426956 GGTGCAGGAGCTGGGGCACTGGG + Intergenic
1065188881 10:23193010-23193032 GCTGCAGCAGCTGCGGCAGGCGG + Exonic
1065917336 10:30364835-30364857 ACTGCTGGAGCTGCAGGAGCTGG - Intronic
1066296278 10:34056663-34056685 AGTGCAGAGGCTGAGGCAGGAGG + Intergenic
1067078064 10:43199236-43199258 ACAGCAGGAGCTGGGGCCGCCGG + Intronic
1067580656 10:47443536-47443558 AGTGCAGGGGCTGGGTGAGCTGG - Intergenic
1069503055 10:68971508-68971530 AGTGCATGAGCTACTGCACCTGG + Intronic
1069639422 10:69945225-69945247 AGGGCAGGAGCTTCTGCAGAGGG + Intronic
1069706114 10:70459885-70459907 TGTGGAGAAGGTGCGGCAGCTGG - Intergenic
1070819576 10:79347069-79347091 ACTGCAGGACCTAGGGCAGCAGG + Intergenic
1071055344 10:81503136-81503158 AGTGCAGGAGCCCAGGCGGCGGG - Intergenic
1071397457 10:85237970-85237992 AGAGCAGCAGCAGCAGCAGCAGG - Intergenic
1071870605 10:89789973-89789995 AGCACAGAAGCTGCGGCAGGTGG - Intergenic
1072731513 10:97850007-97850029 CCTGCAGGAGCCGCGGCAGCGGG + Intergenic
1073293539 10:102425061-102425083 AGTGCTGGAGCTGGAGCTGCCGG - Intronic
1074530742 10:114297194-114297216 AGTGCTGGAACTGCGGCCTCTGG - Intronic
1075091512 10:119446511-119446533 TCTGCAGGGGCTGCAGCAGCTGG - Intronic
1076044791 10:127283096-127283118 AAAGCAGGAGGTGCAGCAGCTGG - Intronic
1076109721 10:127851278-127851300 TGTGCAGGAGCAGCGTCTGCGGG + Intergenic
1076155504 10:128202085-128202107 AGGGCTGGAGCTGGAGCAGCTGG - Intergenic
1076613956 10:131744043-131744065 TGTGCAGGAGCCAGGGCAGCTGG + Intergenic
1076781940 10:132729235-132729257 AGTGCAGGGGCCTCGGGAGCCGG + Intronic
1077920635 11:6639607-6639629 GGTGCAAGAGCTGAGGCAGATGG - Intronic
1078978578 11:16505764-16505786 GGAGCTGGAGCTGGGGCAGCTGG - Intronic
1079465294 11:20723992-20724014 ACTGCTGGAGCTGGAGCAGCTGG + Intronic
1081575437 11:44316275-44316297 GGGGCAGGGGCTGCGGCGGCTGG - Intergenic
1081867196 11:46366465-46366487 AGTGCTGGAGCGCCGGCGGCTGG - Exonic
1083366884 11:62146762-62146784 GGAGCAGGAGCGGCGGGAGCAGG + Exonic
1083366892 11:62146807-62146829 CGAGCAGGAGCGGCGGGAGCAGG + Exonic
1083591916 11:63900552-63900574 CCTGCAGGAGCTGCGGGAACGGG + Exonic
1083605192 11:63974581-63974603 AGTTCTGGAGCTGGGGAAGCAGG - Intergenic
1084189711 11:67493397-67493419 GGTGCAGGAGGTGCGGCGGCTGG - Exonic
1084693779 11:70741988-70742010 AGTCCTGTAGCTGGGGCAGCAGG - Intronic
1088563068 11:111135307-111135329 AGGGCAGTGGCTGCTGCAGCTGG + Intergenic
1090179645 11:124685234-124685256 AGAGCTGGAGCTGAAGCAGCTGG - Intronic
1094496654 12:30993178-30993200 AGTGCAGGAGCTGGGGAGGGTGG - Exonic
1096530916 12:52242442-52242464 GGTGCAGGGGCTGAGGGAGCAGG + Intronic
1099437276 12:82659546-82659568 AAGGCAGTCGCTGCGGCAGCGGG - Intergenic
1099846583 12:88035413-88035435 AGTGCAGAAGCTGAGGCGCCTGG - Intronic
1100209534 12:92387397-92387419 AGTGCAGGAAAAGCGGAAGCTGG - Intergenic
1101159988 12:101963918-101963940 AGGGCAGTGGCTGCAGCAGCTGG + Intronic
1101670711 12:106869693-106869715 ACTTCAGGAGCTGAGGCAGGAGG + Intronic
1102179864 12:110904466-110904488 AGTACAGGAGGTGCGGGATCTGG - Intronic
1103698651 12:122835951-122835973 AGCGCCGGAGCTGAGGCGGCGGG + Intronic
1103719112 12:122964083-122964105 AGAGCAGCAGCTGAGGCGGCTGG - Intronic
1103936720 12:124481077-124481099 ATGGCAGGAGCTGAGGAAGCAGG + Intronic
1104811299 12:131621883-131621905 AGTGCAGGAGCTGCGGCAGCAGG - Intergenic
1104830500 12:131747618-131747640 AGGGCAGGAGGTGCTGCAGCTGG + Intronic
1104892065 12:132144832-132144854 ACTGCAGGAGAGGCGGCGGCAGG - Exonic
1104981529 12:132575037-132575059 AGGCTAGGAGCTGCGGGAGCGGG + Intronic
1106099938 13:26685704-26685726 GGTGCAGGAGCAGCGGGAGCAGG + Exonic
1107468178 13:40667273-40667295 ACTGCAGGAGCCGCGGCGCCGGG - Intergenic
1107559179 13:41545091-41545113 AGGGCAGCTGCTGCGGCAGAAGG + Intergenic
1108167082 13:47704680-47704702 AATGCAGCAGCTGCCTCAGCTGG - Intergenic
1109189557 13:59308254-59308276 ACTGCTGGAGCTGAAGCAGCTGG + Intergenic
1112091824 13:96090945-96090967 GGTGCAGGAGCTGGTGCAGGAGG - Exonic
1113838179 13:113343321-113343343 AGTGCAGCAGCAGCAGCAGCAGG - Intronic
1114476446 14:22998537-22998559 GATTGAGGAGCTGCGGCAGCTGG - Exonic
1115217205 14:31025863-31025885 TGTGCGGGAGCTGCGGCGGCTGG - Intronic
1115304691 14:31922196-31922218 AAGGGAGGAGCTGGGGCAGCCGG - Intergenic
1117907484 14:60605596-60605618 ACAGCTGGAGCTGAGGCAGCTGG - Intergenic
1117908252 14:60612160-60612182 ACAGCTGGAGCTGAGGCAGCTGG + Intergenic
1118247922 14:64129639-64129661 AGAGCAGGAGGTGAGGGAGCGGG + Intronic
1118258450 14:64225397-64225419 AGGCCAGGAGCAGCAGCAGCAGG - Exonic
1120995973 14:90419102-90419124 AGGGAGGGAGCTGGGGCAGCAGG + Intergenic
1121318772 14:92978623-92978645 ACTGCTGGAGCTGGAGCAGCTGG - Intronic
1121360048 14:93248595-93248617 ACTGCAGGAACTGCGGCACACGG - Exonic
1121844375 14:97160017-97160039 AATGAAGGAGCTGAGCCAGCTGG - Intergenic
1122022872 14:98853920-98853942 GGTGCAGGAGCCTGGGCAGCTGG + Intergenic
1122100127 14:99401971-99401993 AGGCCAGGAGCTCCTGCAGCAGG + Intronic
1122813672 14:104301716-104301738 AGTCCAGGAAATGAGGCAGCTGG - Intergenic
1123105958 14:105841153-105841175 AGTGCAGGACCTGTGGCTCCGGG - Intergenic
1202834433 14_GL000009v2_random:67367-67389 GGAGCAGGTGCTGCGGCTGCTGG - Intergenic
1123762162 15:23441475-23441497 GGAGAAGGAGCTGCGGGAGCAGG - Exonic
1124333938 15:28843281-28843303 GGAGAAGGAGCTGCGGGAGCAGG - Intergenic
1124334675 15:28848163-28848185 AGGGCAGGTGCTGGGGCATCCGG + Intergenic
1124645320 15:31434289-31434311 AATGCAGGATCAGTGGCAGCAGG + Intronic
1125716121 15:41820936-41820958 CATGCTGGATCTGCGGCAGCTGG + Exonic
1125771094 15:42166563-42166585 AGTGCAGTATCTGCAGCATCTGG - Exonic
1126942109 15:53778741-53778763 ATTGCTGGAGCTGAAGCAGCTGG + Intergenic
1127144094 15:56007229-56007251 GGTGCTGGTGCTGCGGCGGCTGG + Intergenic
1127144103 15:56007271-56007293 GGTGCTGGTGCTGCGGCGGCGGG + Intergenic
1128582754 15:68820495-68820517 AGGGCAGCGGCGGCGGCAGCCGG + Intronic
1130033501 15:80337022-80337044 AGTGAAGGAGCTGCAGGACCTGG + Intergenic
1130836620 15:87656050-87656072 AGTCCAGGAGCTGGGTCAACAGG + Intergenic
1131111682 15:89768383-89768405 CGTGCAGGAGCTGGAGCAGATGG - Intronic
1131269082 15:90935552-90935574 AGTGGAGCAGCTGCGGAAGGAGG + Exonic
1132144579 15:99421370-99421392 AGTGGAGGAGCAGAGGCAGTGGG - Intergenic
1132414941 15:101613092-101613114 TGTGCAGGGGCTGGGGCTGCTGG + Intergenic
1132600462 16:770594-770616 GGTGGAGGAGCTGCGGCACCTGG - Exonic
1132904246 16:2274022-2274044 AGTGCTGGAGCTGGGTCACCAGG - Intergenic
1132938700 16:2496241-2496263 ACTGCAGGAACTGAAGCAGCTGG + Exonic
1133113407 16:3563022-3563044 AGTAGAGCAGCTGGGGCAGCAGG + Exonic
1135415906 16:22267767-22267789 AGAGCTGGAGCTGAAGCAGCAGG + Intronic
1135555696 16:23434656-23434678 AGGCCAGGAGCTGGGGCATCCGG + Exonic
1135771930 16:25224415-25224437 AGTCCAGGAGCAGGGGCAGGTGG + Exonic
1136030007 16:27495906-27495928 AGTGCAGCACCTGCGGCAGGAGG + Intronic
1136065801 16:27757515-27757537 AGGTCAGGAGCTGGGTCAGCAGG - Intronic
1136083596 16:27868820-27868842 ATTGCAGGAGCTATGGCAGAGGG - Intronic
1136416339 16:30106453-30106475 GCTGCAGGAGCTGGGGCAGGTGG - Intronic
1136429164 16:30186939-30186961 AGTGCAGGTGCTGCGGGAGGAGG + Exonic
1136536361 16:30902179-30902201 AGTGCACGAGCGGCTGCGGCTGG + Exonic
1138512430 16:57516334-57516356 GGTGAAGAAGCTGCGGCTGCGGG - Exonic
1139459411 16:67109968-67109990 CCTGCAGCAGCCGCGGCAGCGGG - Exonic
1140029888 16:71327238-71327260 AGTTCAAGAGCTACTGCAGCCGG + Intergenic
1140450303 16:75065259-75065281 AGTGCAGGAGCCTCAGCCGCAGG - Intronic
1141583876 16:85020018-85020040 AGTACAGGAGCAGAGCCAGCTGG + Intergenic
1141989703 16:87602833-87602855 GGGGCAGGAGCGGCGGCGGCGGG - Intronic
1142426897 16:90006305-90006327 CCTGCAGGAGCTGGGGCAGGTGG + Exonic
1142496083 17:307004-307026 AGTGGAGCAGATGTGGCAGCCGG - Intronic
1142749357 17:1978077-1978099 AGTGCAGGAGGCGGGGCCGCGGG - Intronic
1142938765 17:3362947-3362969 ACAGCTGGAGCTGCAGCAGCTGG + Intergenic
1143898610 17:10156550-10156572 GGTGCAGGAGCTGCAGGAGAAGG - Intronic
1144812680 17:18010746-18010768 AGGGCAGGGGCTGAGGCTGCGGG + Intronic
1145772212 17:27501594-27501616 ATTGCTGGAGCTGGAGCAGCTGG - Intronic
1145914565 17:28564094-28564116 AAGGCAAGAGCTGCGGCAGATGG - Intronic
1146650413 17:34602860-34602882 AGGGCAGAAGCTGGGGAAGCAGG + Intronic
1146907817 17:36629403-36629425 AGTGGGTGAGCTGCGGCGGCAGG + Intergenic
1146956596 17:36939661-36939683 AAAGCGGGAGCTGCGGGAGCTGG - Intronic
1147602577 17:41755356-41755378 AGTGCCTGAGCTGGGGAAGCCGG - Exonic
1147679015 17:42227600-42227622 GGTGCAGGAGCTGCAGAAGAAGG - Exonic
1147686647 17:42289929-42289951 GGTGCAGGAGCTGCAGAAGAAGG + Exonic
1148043961 17:44730979-44731001 AGGGAAGGAGCTGCTGCAGAAGG + Exonic
1148131950 17:45267412-45267434 GGAGCAGGAACTGCAGCAGCTGG - Exonic
1148821947 17:50364949-50364971 GGTGCAGCAGCAGCAGCAGCAGG - Intergenic
1148839311 17:50484501-50484523 GGTGCAGGAGCTGCTGGAGCGGG + Exonic
1149990447 17:61380258-61380280 AGTGTAGGAACTCAGGCAGCTGG + Intronic
1150212376 17:63448167-63448189 AAGGCAGGAGCTTCGGCAGCAGG - Intergenic
1150590808 17:66560539-66560561 ATTCCAGGAGATGCAGCAGCTGG - Intronic
1150851613 17:68708592-68708614 ACTCCAGAAGCTGCGGCAGGAGG + Intergenic
1151479140 17:74360153-74360175 CTTGCAGGAGCTGCTGCGGCAGG - Exonic
1151495124 17:74454197-74454219 ACAGCAGGAGCTGGGACAGCTGG - Intergenic
1151563711 17:74885139-74885161 TGTGCAGTAGCAGCAGCAGCTGG + Intronic
1151882787 17:76905044-76905066 AGTGCAGGAGAAGCTGGAGCAGG + Intronic
1152017774 17:77762992-77763014 AGGGCAGGAGCTGGGGGTGCTGG + Intergenic
1152017957 17:77764272-77764294 AGGGCAGGAGCTGGGGGTGCTGG + Intergenic
1152283770 17:79400700-79400722 AGAGCAGGAGCTGCTGCATTTGG - Intronic
1152456895 17:80421920-80421942 GGTGCAGCAGCTGCGGGAGAAGG + Exonic
1152757039 17:82091393-82091415 CGTGCAGAAGCTGCTGGAGCAGG - Exonic
1152759511 17:82100663-82100685 AGTGCAGGGGTGGAGGCAGCCGG - Intergenic
1154191247 18:12232390-12232412 GGTGCAGGGGCTGGGGCATCGGG - Intergenic
1154424362 18:14260737-14260759 AGAGCAGGAGCTGGGGCTGCAGG - Intergenic
1154427050 18:14280090-14280112 GGAGCAGGAGCTGGGGCTGCTGG - Intergenic
1154429777 18:14299622-14299644 GGAGCAGGAGCTGGGGCTGCCGG - Intergenic
1154432051 18:14315966-14315988 GGAGCAGGAGCTGGGGCTGCCGG - Intergenic
1155171317 18:23268652-23268674 AATGCAGACGCTGGGGCAGCAGG + Intronic
1155368376 18:25072012-25072034 TGTGTAGGAGCTGAGGCATCTGG + Intronic
1156353746 18:36323172-36323194 AGAGGAGGAGCAGAGGCAGCCGG - Intronic
1157605429 18:48923200-48923222 AGAGGAGGAGCTGGGGCTGCAGG - Intronic
1160832040 19:1108648-1108670 GCTGCAGGAGCTGCGGCTGATGG - Exonic
1161466405 19:4433077-4433099 CGTGCAGGAGCGGCAGCAGCTGG - Exonic
1161595841 19:5150645-5150667 CGCCCAGGAGCTGCGGCACCAGG - Intronic
1162299317 19:9835318-9835340 GGAGCAGGCGCTGCGGCAGGAGG + Exonic
1162523095 19:11193473-11193495 CCTGCGGAAGCTGCGGCAGCTGG - Exonic
1162904969 19:13817936-13817958 GGTGCAGGTGCTGCGCAAGCAGG + Exonic
1163104638 19:15116260-15116282 AGTGCAGGTGCTGCAGCTGGTGG - Exonic
1163323423 19:16587718-16587740 ATTACAGGAGCTGTGGCTGCAGG - Intronic
1163442458 19:17328771-17328793 AGGGCGGGGGCGGCGGCAGCGGG - Exonic
1164309570 19:24033922-24033944 GTGGCAGGAGCTGCGGCAGGTGG + Intronic
1165327994 19:35125315-35125337 ACTGCAGGAGCTGGGGCCTCCGG - Exonic
1166373117 19:42313409-42313431 GGAGCAGCAGCGGCGGCAGCAGG - Exonic
1166813128 19:45526144-45526166 CGTCCAGGAGCTGAGGAAGCGGG + Exonic
1166856697 19:45785893-45785915 ACTGCAGGAGCGGCGGGACCGGG - Exonic
1167217104 19:48171847-48171869 GGAGCAGGAGCTGCGGGAGCGGG + Exonic
1167423522 19:49417408-49417430 AGAGCAGCAGCAGCAGCAGCAGG - Exonic
1168273253 19:55261854-55261876 AGTGCAGGAGCAGCCACACCTGG - Intergenic
1168631120 19:57956926-57956948 GTTCCAGGAGCTGGGGCAGCAGG - Intergenic
1202638250 1_KI270706v1_random:60325-60347 GGAGCAGGAGCTGCGGCTGCTGG + Intergenic
926152514 2:10432851-10432873 GGCGCAGGAGCTGCGGGGGCGGG + Intergenic
926795848 2:16618202-16618224 AGTGCAGGAGCAGGGGCAAGAGG + Intronic
927478532 2:23432728-23432750 TGTGCAGGTGCTGAGGCAGGAGG + Intronic
927520181 2:23693738-23693760 AGTGCAGGTGCTGCGGCTCTTGG - Intronic
927639961 2:24840083-24840105 CCTGCAGGAGCAGGGGCAGCTGG - Intronic
927850425 2:26495139-26495161 GGTCCAGGGGCTGGGGCAGCAGG + Intronic
927872395 2:26631884-26631906 AGAGCTGGAGCTGCAGAAGCTGG - Intronic
927881531 2:26692992-26693014 GCGGCTGGAGCTGCGGCAGCAGG + Exonic
928397060 2:30950771-30950793 AGAGAAGGAGCGTCGGCAGCAGG + Intronic
928975699 2:37084329-37084351 AGTGCGGGAGGTGGGGCATCCGG - Exonic
929117672 2:38457840-38457862 CGAGCAGGAGCTGAGGCATCAGG - Intergenic
929313546 2:40452074-40452096 CGAGCGGGAGCCGCGGCAGCGGG + Intronic
931116936 2:59175084-59175106 TCTGGAGGAGCAGCGGCAGCGGG - Intergenic
933654916 2:84879743-84879765 AAGGCAGGAGGCGCGGCAGCTGG - Intronic
933737225 2:85504810-85504832 AGTGCTGGTGATGCAGCAGCAGG - Intergenic
934118230 2:88815671-88815693 ACTGCTGGAGCTGGAGCAGCTGG - Intergenic
934493691 2:94779774-94779796 AGAGCAGGAGCTGGGGCTGCTGG + Intergenic
934772013 2:96913229-96913251 AGTGCAGAGGCTTCAGCAGCAGG + Intronic
935442990 2:103123533-103123555 AGGGCAGCAGCTGAGGCACCTGG - Intergenic
935902878 2:107811293-107811315 AGGCCAGGAGCTGGAGCAGCTGG - Intergenic
936161783 2:110088948-110088970 GCTGCTGGAGCTGGGGCAGCCGG - Intronic
936182880 2:110282406-110282428 GCTGCTGGAGCTGGGGCAGCCGG + Intergenic
937122753 2:119452108-119452130 TGAGCAGGAGCTGTGGGAGCTGG + Intronic
937321844 2:120965668-120965690 GATGCAGGTGCTGCGGCAGAGGG + Intronic
937746345 2:125420372-125420394 AGTGAAGGAGCTGCAGAAGTGGG + Intergenic
938292455 2:130157333-130157355 CGTGCAGGTGCTTCAGCAGCAGG + Exonic
938464099 2:131515643-131515665 CGTGCAGGTGCTTCAGCAGCAGG - Intergenic
940328184 2:152447207-152447229 ACTGGAGAAGCTGAGGCAGCAGG - Intronic
941525203 2:166598160-166598182 ATTGCTGGAGCTGGAGCAGCTGG + Intergenic
942829697 2:180225122-180225144 AGTGCTGGAGTTGAAGCAGCTGG - Intergenic
944602744 2:201320326-201320348 AGTGCAGGAGCTGCCAGTGCAGG + Intronic
946264036 2:218522858-218522880 AGGGCATGAGCTGCCGCATCCGG - Intronic
946400671 2:219466769-219466791 GGTGCAGGAGCAGGGGCAGGGGG + Intronic
947565959 2:231193286-231193308 AGTGGGGAAGCTGAGGCAGCTGG + Intergenic
948151012 2:235744653-235744675 AGAGCAGGAGCTGAGTGAGCAGG - Intronic
948449477 2:238060524-238060546 AGTGCCGGGGCCGCGGCAGCAGG - Intronic
948746123 2:240095571-240095593 GGTGCAGGAGCTGCGGGTGCAGG + Intergenic
948746164 2:240095705-240095727 GGTGCAGGAGTTGCGGATGCGGG + Intergenic
948746191 2:240095795-240095817 GGTGCAGGAGCTGCGGGTGCTGG + Intergenic
948902970 2:240965455-240965477 GGTGCTGGAGCTGCGGAGGCAGG + Intronic
948994396 2:241571192-241571214 AGGGCGGGGGCTGGGGCAGCGGG - Intronic
1168869886 20:1119005-1119027 AGTGCAGGGTCTGGGGCAGATGG + Intronic
1168913161 20:1466446-1466468 ACTTCGGGCGCTGCGGCAGCCGG - Intronic
1169318139 20:4609838-4609860 GGTGCAGGAGCTGCTGCTGAGGG - Intergenic
1169832466 20:9839191-9839213 CGTGCAGGAGCTGCCCCCGCCGG - Intergenic
1171364836 20:24616660-24616682 GGTGCAGGGGGTGAGGCAGCTGG + Intronic
1171399120 20:24860311-24860333 AGTGCAGGAGCTGGGTCACGAGG - Intergenic
1171519977 20:25768277-25768299 AGTGCAGGAGCAGAGGGAGTGGG - Intronic
1171556942 20:26088216-26088238 AGTGCAGGAGCAGAGGGAGTGGG + Intergenic
1172271978 20:33659955-33659977 AGAGCAGGCTCTGCGGCAGCCGG - Exonic
1174062578 20:47843221-47843243 ACTGGAGGAGCTGAGGCTGCGGG - Intergenic
1175189550 20:57202151-57202173 AGTGCAGGTTCTGATGCAGCAGG + Intronic
1175954867 20:62604076-62604098 TGGGCAGGTGCTGCGGCAGGAGG - Intergenic
1176654105 21:9574560-9574582 ACTGCAGGAGCAGAGGGAGCGGG - Intergenic
1176844984 21:13869789-13869811 GGTGCAGGAGCTGGGGCAGCCGG + Intergenic
1178203834 21:30440503-30440525 AGTGCAGGATGTCTGGCAGCTGG - Exonic
1178472341 21:32904709-32904731 AGGGCAGGAGCTGATGCTGCAGG + Intergenic
1179480494 21:41673767-41673789 AGTGCAGGTGCCAGGGCAGCAGG - Intergenic
1179540898 21:42082742-42082764 ACTGCAGGCTCTGCGGCATCGGG + Intronic
1179839586 21:44062643-44062665 GGTGCAGGGGCTGGGCCAGCGGG + Intronic
1179873490 21:44255704-44255726 TGTGCAGGCGCTGCGGGATCAGG + Intronic
1179940680 21:44637437-44637459 AGTGCAGGCGCTGGAGCAGATGG - Exonic
1180363716 22:11921554-11921576 GGAGCAGGAGCTGTGGCTGCTGG - Intergenic
1180942564 22:19668926-19668948 AAAGCAGGAGCTGCGGTCGCGGG + Intergenic
1180975933 22:19848441-19848463 AAAGCAGGTGCTGCAGCAGCTGG + Exonic
1181027527 22:20134475-20134497 AGGGCAGGAGGTGGGGCAACGGG - Intronic
1181224651 22:21384053-21384075 CGAGCGGGAGCGGCGGCAGCTGG + Exonic
1181253981 22:21550760-21550782 CGAGCGGGAGCGGCGGCAGCTGG - Exonic
1181455826 22:23059662-23059684 AGTGCAGCAGCTCCAGGAGCAGG + Exonic
1182519524 22:30877574-30877596 AGTGAAAAAGCTGCGGGAGCAGG + Intronic
1182557351 22:31136517-31136539 AGAGCTGGACCTGGGGCAGCAGG + Intronic
1183386187 22:37516143-37516165 AGGGCTGGAGCAGCGGCTGCGGG - Exonic
1183583762 22:38740380-38740402 TGTGAAGGAGCTGAGGCGGCTGG - Exonic
1183641818 22:39097424-39097446 AGGGCTGGGGCTGGGGCAGCGGG - Intronic
1183945760 22:41324918-41324940 GGTGCAGGGGCTGCTGCAGCAGG - Intronic
1184253609 22:43274848-43274870 TGTGCATGAGGGGCGGCAGCGGG + Intronic
1184520451 22:44990978-44991000 TGTGGAGGAGCCGCGGCAGCAGG - Intronic
1185121501 22:48974400-48974422 AGTGAAGGAGCAGAGGCACCTGG - Intergenic
1185171840 22:49298882-49298904 GGTGGAGAAGCTGCTGCAGCGGG - Intergenic
1185306350 22:50119366-50119388 AGTGCAGGACCTGTGACAGGCGG - Intronic
1185384120 22:50523958-50523980 GGTGCAGGTGGTGCGGCAGCTGG - Exonic
949947544 3:9202458-9202480 TGTGCAGGAGCTGCCCCAGGAGG - Intronic
950020024 3:9780506-9780528 CCGGCAGGAGCTGAGGCAGCGGG - Exonic
950604312 3:14064796-14064818 GGTGCTGGAGCTGCTGCTGCTGG - Exonic
950841753 3:15974697-15974719 GCTACAGGAGCTGCTGCAGCTGG + Intergenic
951709055 3:25571293-25571315 AGTGCAGGTTCTGGTGCAGCAGG + Intronic
952125030 3:30290595-30290617 AGTGCTGGGGCCGCTGCAGCTGG - Intergenic
954405256 3:50341817-50341839 AGAGCAGGACCTGCGGCTGCAGG - Exonic
954909293 3:54089087-54089109 AGTCCAGGAGCTGGTGCAGAGGG - Intergenic
955082986 3:55675043-55675065 AGTGCAGGATCTGCTTCAGAGGG + Intronic
958421039 3:93931818-93931840 AGAGTATGAGCTGTGGCAGCGGG - Intronic
958928052 3:100180059-100180081 ACAGCTGGAGCTGGGGCAGCTGG + Intergenic
960358313 3:116679805-116679827 AGTGCAAGAGCTGTGGATGCAGG + Intronic
960484108 3:118229709-118229731 AGTGCAGGTGATGAAGCAGCTGG - Intergenic
961536265 3:127572880-127572902 GGGGCAGGGGCAGCGGCAGCTGG + Intergenic
961717866 3:128870998-128871020 AGTGAAGTAGCTGCCCCAGCTGG - Intergenic
961978133 3:131048246-131048268 AGCACAGAAGCTGCGGCAGGTGG - Intronic
962104732 3:132379014-132379036 AGGGCAGGAGTTACAGCAGCAGG + Intergenic
962713978 3:138111406-138111428 AGTGCAGGAGTCCCGGCAGGTGG + Intronic
964711872 3:159679738-159679760 ACAGCAGGAGGTGCGCCAGCGGG - Intronic
965731321 3:171774978-171775000 ACTGAAGGAGCAGCTGCAGCTGG + Intronic
966913005 3:184569617-184569639 GGACCAGGGGCTGCGGCAGCGGG + Intronic
967527691 3:190513936-190513958 CTTCCAGGAGCTGCGGCCGCGGG - Intergenic
967829804 3:193909293-193909315 CCTGCAGGAGCTGGGGCAGGAGG + Intergenic
968502031 4:955304-955326 AAAGCAGGGGCTGCGGCAGAAGG - Intronic
969535786 4:7755420-7755442 AGAGCAGGAGCCGGGGAAGCAGG - Intergenic
969627535 4:8315203-8315225 AGTGCAGGAGCCGCTGCTGAAGG - Intergenic
970332925 4:15003450-15003472 AGGGAGGGAGCTGCGGGAGCGGG - Exonic
971418302 4:26453472-26453494 TGGGCAGGAGCAGGGGCAGCAGG + Intergenic
971631453 4:28998500-28998522 AGGGCTGGAGCTGAAGCAGCTGG - Intergenic
972828459 4:42787461-42787483 ATTGCTGGAGCTGCAGCTGCTGG + Intergenic
973982008 4:56315056-56315078 GGTGGAGGAGCTGCGGTGGCAGG + Exonic
975668556 4:76757029-76757051 GGTTCAGGAGCTGTGGCAGTAGG - Intronic
975778973 4:77819647-77819669 GGTGCTGGTGCTGCGGCGGCGGG + Intergenic
977979769 4:103307727-103307749 GTTGCAGGAGCTGCAGCTGCTGG + Intergenic
978856888 4:113403808-113403830 ACTGCAGGAGCTGGGGCTGGAGG - Intergenic
978919239 4:114162378-114162400 AGTGCAGGAGGTGATACAGCAGG + Intergenic
979448269 4:120839864-120839886 AGCGGGGGAGCTGAGGCAGCGGG + Intronic
979789259 4:124757636-124757658 AGAGCAGAAGCAGCAGCAGCAGG - Intergenic
981128590 4:141133297-141133319 AGGGCAGCAGCGGCTGCAGCTGG - Intronic
982067338 4:151665938-151665960 AGCTCAGGGGCTGCGCCAGCGGG - Intergenic
982462268 4:155685536-155685558 GGTGGAGGAGCTGCGGAAGCTGG - Intronic
983379092 4:166968480-166968502 ATTGCTGGAGCTGGAGCAGCTGG - Intronic
983535682 4:168854583-168854605 ACAGCAGGAGCGGCGGCACCTGG - Intronic
984372149 4:178882229-178882251 ACAGCAGGAGCTGGAGCAGCTGG - Intergenic
984915274 4:184718098-184718120 GGTGCAGAAGGTGCTGCAGCTGG - Intronic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
1202765589 4_GL000008v2_random:146183-146205 GGAGCAGGAGCTGCGGCTGCTGG + Intergenic
985549829 5:527400-527422 AGTTCAGATGCTGTGGCAGCTGG - Intergenic
985913048 5:2897791-2897813 AGTGCCGTGGCTGCTGCAGCAGG + Intergenic
986297678 5:6453070-6453092 ACTGCAGCAGCAGCAGCAGCAGG + Intronic
986392809 5:7301318-7301340 GGAGAAGGAGCTGCGGGAGCAGG - Intergenic
987086484 5:14474358-14474380 AGGCCAGCAGCTCCGGCAGCTGG - Intronic
987675022 5:21063391-21063413 ATAGCCGGAGCTGGGGCAGCTGG - Intergenic
989132810 5:38124431-38124453 ACTGCTGGAGCTGAAGCAGCTGG + Intergenic
990210545 5:53478918-53478940 GGTGCAGGTGCGGCGGCCGCGGG + Intergenic
992179303 5:74181174-74181196 AGTGCAGGAGCTGGGGCCTTTGG + Intergenic
993056588 5:82988387-82988409 AGGGCAGGGACTGTGGCAGCTGG - Intergenic
993613642 5:90084411-90084433 AATGCAGAAGCTGCAGCAGTAGG + Intergenic
996337509 5:122400767-122400789 GGTGAAGAAGCTGAGGCAGCTGG + Intronic
998218026 5:140252284-140252306 AGGGCAGGAGATGAGCCAGCAGG - Intronic
1001107145 5:168864099-168864121 ACTGCAGGGGCTGAGGCAGAAGG + Intronic
1001671661 5:173478729-173478751 AGTGCAGGAGTTGTGGGGGCGGG - Intergenic
1001929871 5:175665263-175665285 GGTACAGGAGCTGCAGGAGCTGG + Intronic
1002054217 5:176589493-176589515 TGTGCAGGAGATGAGGCACCAGG - Intronic
1002105634 5:176878237-176878259 ACTGCAGGAGGTGGTGCAGCTGG + Exonic
1002695787 5:181087446-181087468 AGAGCAGGAGCAGGGACAGCAGG + Intergenic
1005033923 6:21537827-21537849 TGTGCAGCAGCTGCAGCAGTTGG - Intergenic
1006027200 6:31154717-31154739 GCTGCAAGAGCTGCGGCGGCTGG - Exonic
1006122718 6:31816917-31816939 CGTGCAGGACCTGCTGCTGCTGG + Exonic
1006124581 6:31829111-31829133 CGTGCAGGACCTGCTGCTGCTGG + Exonic
1007247098 6:40470741-40470763 AATGCAGGAGCTGAGGCAAGGGG - Intronic
1007264919 6:40588774-40588796 ACTGCAGAAGCCGAGGCAGCTGG + Intergenic
1008540048 6:52538434-52538456 AGGGCAGGAGCTGGGCCAACCGG + Intronic
1010269547 6:73904599-73904621 AGTACAGGAAATGCGGAAGCTGG - Intergenic
1010360432 6:74987061-74987083 ACTGCAGGAGCTGGAGCAGCCGG - Intergenic
1010678066 6:78767709-78767731 ATGGCGGGAGCTGGGGCAGCTGG - Intergenic
1010819406 6:80395854-80395876 AGAGCTGGAGCTGAAGCAGCTGG - Intergenic
1013360981 6:109393748-109393770 AATGCAGGAGCTGTGGAAGAAGG - Intronic
1013587158 6:111589681-111589703 AGGGCAGGGGCTGGGGAAGCAGG - Intronic
1015029774 6:128580663-128580685 GGTGCAGGAGCTGCAGCAGGCGG - Intergenic
1016753248 6:147654629-147654651 ATAGCAGCAGCAGCGGCAGCAGG - Intronic
1017684789 6:156901444-156901466 GGTGCGGGGGCTGCGGCTGCTGG - Exonic
1017955917 6:159177530-159177552 AGGGCAGGACCTGGGGCAGGTGG + Intronic
1018272301 6:162093367-162093389 AGTGCAGGAACTGCCGCCTCTGG - Intronic
1018903297 6:168061819-168061841 TCTGCAACAGCTGCGGCAGCGGG - Exonic
1019120011 6:169794746-169794768 AGTGCAGGAGCAGGTGCTGCTGG + Intergenic
1019129739 6:169864849-169864871 TTTGCTGGAGCTGCGGCAGCAGG + Intergenic
1019162981 6:170081204-170081226 AGGGGAGGAGCTGCAGCCGCAGG + Intergenic
1019173017 6:170145429-170145451 AGGGCAGTAGCTGCCCCAGCGGG + Intergenic
1019666122 7:2253014-2253036 AGGGCAGGAGTTGGGGGAGCAGG - Exonic
1020012696 7:4815379-4815401 ACTCCAGGAGCTGCTGCAGGCGG + Exonic
1020427580 7:8086466-8086488 CCTGCAGGAGCTGCTGCTGCTGG - Exonic
1020730097 7:11869480-11869502 ATGGCTGGAGCTGAGGCAGCTGG - Intergenic
1022094477 7:27130298-27130320 GCTGCAGGGGCGGCGGCAGCTGG + Exonic
1022098045 7:27152972-27152994 TGGGCAGGGGCTGGGGCAGCTGG - Intergenic
1022514126 7:30964672-30964694 AGTGCTGGAGCAGAAGCAGCTGG - Intronic
1023000157 7:35800653-35800675 AGTTTTGGAGCTGCGGGAGCCGG - Intergenic
1023418127 7:39950770-39950792 GTTGCAGGAGCTGCGGCTGCAGG - Exonic
1024056369 7:45662127-45662149 AGTGCATGAGCTGCACCAGCAGG - Exonic
1024223449 7:47305459-47305481 AGTGCAGGCCCTGCGGCAGCCGG + Intronic
1024541584 7:50479521-50479543 ATTGCAGGAGCAGGGGCAGGTGG - Intronic
1025261739 7:57424849-57424871 ACAGCAGGCGCTGCGGCAGCTGG - Intergenic
1025280456 7:57623234-57623256 AGTGCAGGAGCAGAGGGAGTGGG - Intergenic
1025304275 7:57842273-57842295 AGTGCAGGAGCAGAGGGAGTGGG + Intergenic
1025610347 7:63071889-63071911 GCTGCAGGAGCTGCAGGAGCTGG - Intergenic
1025761028 7:64391897-64391919 CATGCAAGAGCTGTGGCAGCAGG + Intergenic
1025997701 7:66538412-66538434 AGTGCAGTAGCTGGGGCTACAGG - Intergenic
1026942501 7:74295336-74295358 AGTTGAGAAGCTGGGGCAGCAGG + Intronic
1029378985 7:100200304-100200326 TGGCCAGGAGCTGGGGCAGCAGG - Exonic
1029446334 7:100614970-100614992 CGTGCAGGACTTGAGGCAGCTGG - Exonic
1031583491 7:123505609-123505631 AGAGCAGGAGCTGGAGTAGCTGG + Intronic
1031688915 7:124764995-124765017 TAAGCAGGAGCTGCGGCTGCCGG - Exonic
1032675620 7:134127547-134127569 GGTGCATGAGCTGCTGGAGCAGG - Exonic
1034269624 7:149797311-149797333 AGTGCAGCAGCTGCCCCGGCTGG - Intergenic
1034501415 7:151453209-151453231 GCTCCAGGGGCTGCGGCAGCTGG + Intergenic
1034508939 7:151519256-151519278 GGTGGAGGAGCCGCGGTAGCTGG - Intronic
1034543840 7:151777016-151777038 ACTGCAGGAGCTCCAGCTGCGGG - Intronic
1035271089 7:157720396-157720418 AGAGCAGGAGCTGCAGGAGGCGG - Intronic
1036026563 8:4915570-4915592 AGGGCAGGAGCAGGGACAGCTGG + Intronic
1037813364 8:22099337-22099359 CGTGCAGGAGCTGGGGCTGCAGG - Exonic
1037824307 8:22151852-22151874 GGTGCAGGACCTGCCGCTGCGGG - Exonic
1042606629 8:70552849-70552871 AGTGCAGCAGCTGCTGCATCTGG - Intergenic
1042989270 8:74620634-74620656 AGGGCTGGAGCTGAAGCAGCTGG + Intronic
1043053416 8:75408153-75408175 GGCGCTGGAGGTGCGGCAGCGGG + Intronic
1043454848 8:80402871-80402893 AGAGCAGGACCTGTGGCTGCAGG - Intergenic
1043982422 8:86657724-86657746 GCTGCAGGAGCTGCAGGAGCTGG - Intronic
1045287380 8:100803834-100803856 AGTGAAGGAGCTGCAGCTTCTGG - Intergenic
1047591944 8:126336194-126336216 AGTGCAGGAGCTGCCACGGATGG + Intergenic
1047951564 8:129939708-129939730 AGCGGGGGAGCGGCGGCAGCCGG + Exonic
1049435535 8:142584562-142584584 CGTGCAGGACCTGCGGTGGCTGG + Intergenic
1049472472 8:142782631-142782653 TGTGCAGGAGCCCCGGCACCCGG + Intergenic
1049681787 8:143922071-143922093 GGAGCAGCAGCGGCGGCAGCAGG - Exonic
1049682377 8:143925296-143925318 CCTGGAGGAGCTGCGGCTGCAGG - Exonic
1049724526 8:144139456-144139478 GGAGCAGCAGCTGCAGCAGCTGG + Exonic
1049739822 8:144233326-144233348 GGTGCAGGAGCTGCGGGGGAGGG - Intronic
1049739833 8:144233362-144233384 GGTGCAGGAGCTGCGGGGGAGGG - Intronic
1049739845 8:144233398-144233420 GGTGCAGGAGCTGCGGGGGAGGG - Intronic
1049790111 8:144468541-144468563 GGTGCAGGAGGTGCAGCTGCAGG + Exonic
1049795681 8:144496343-144496365 AGGGCAGGACCTGAGACAGCTGG + Intronic
1051609934 9:18951268-18951290 AGGGGAGGACCTGGGGCAGCTGG - Intronic
1051881104 9:21840794-21840816 AGTACAGGAGCTGCTGCTGATGG + Intronic
1053427159 9:38017664-38017686 AGTGGTGGAGTAGCGGCAGCGGG - Intronic
1053663394 9:40300258-40300280 GGAGCAGGAGCTGGGGCTGCTGG - Intronic
1053664861 9:40310357-40310379 GGAGCAGGAGCTGGGGCTGCTGG - Intronic
1053913905 9:42930799-42930821 GGAGCAGGAGCTGGGGCTGCTGG - Intergenic
1054375517 9:64446492-64446514 GGAGCAGGAGCTGGGGCTGCTGG - Intergenic
1054521220 9:66076027-66076049 GGAGCAGGAGCTGGGGCTGCTGG + Intergenic
1055667040 9:78563318-78563340 TGTACAAGAGCTGCAGCAGCTGG + Intergenic
1057208750 9:93188171-93188193 ACTGCAGGTGCTGCGGGAGTAGG - Intronic
1057677250 9:97145399-97145421 GGTGCAGGAGCTGGAGCTGCAGG + Intergenic
1057796130 9:98159491-98159513 AGAGCAGGTGCTGGGGAAGCTGG - Intronic
1058572803 9:106365733-106365755 AGTGCAGAAGCTGAGGAGGCAGG - Intergenic
1058662910 9:107283009-107283031 AGAGGCGGAGCCGCGGCAGCCGG + Intergenic
1061114433 9:128600348-128600370 GGTGCAGGATATGCTGCAGCAGG + Intronic
1061365890 9:130172350-130172372 AGCGCAGGGGCGGCGGCAGGCGG + Intergenic
1061631801 9:131876717-131876739 AGGGAAGGAGCGGCGGCAGACGG - Intronic
1061940937 9:133883439-133883461 AGTGGCTGAGCTGCTGCAGCAGG - Intronic
1062076488 9:134592732-134592754 AGGGCAGGCGCTGAGCCAGCTGG + Intergenic
1203546335 Un_KI270743v1:131073-131095 GGAGCAGGAGCTGCGGCTGCTGG + Intergenic
1203631827 Un_KI270750v1:78018-78040 ACTGCAGGAGCAGAGGGAGCGGG - Intergenic
1185452226 X:288794-288816 TGTTCAGCAGCTGCAGCAGCCGG - Exonic
1186154416 X:6710673-6710695 AGTGCAGGAGCTGCTGACGCTGG + Intergenic
1187133618 X:16526164-16526186 ATGGCTGGAGCTGCAGCAGCTGG + Intergenic
1187308824 X:18121749-18121771 TGTGCAGGAGCTGGGGCAGGGGG - Intergenic
1187527017 X:20063473-20063495 ACTGGAAGAGCAGCGGCAGCGGG - Exonic
1188259731 X:28008374-28008396 AGTGCTGGAGATGGGGGAGCTGG + Intergenic
1190055777 X:47180220-47180242 CCTGCAGGATCTGCAGCAGCTGG - Exonic
1190418625 X:50205544-50205566 GGTGCAGTGGCTGCGGCAGGAGG + Intronic
1190727000 X:53196253-53196275 GGTGCAAGAGCTGTGGCAGAAGG - Intronic
1193027095 X:76856151-76856173 AGTGCTGGAGCTGAAGCAGCTGG + Intergenic
1193402396 X:81060832-81060854 ACTTCAGAAGCTGAGGCAGCAGG + Intergenic
1194278171 X:91913254-91913276 AGTACAGGAGCTGCTGCTGATGG + Intronic
1194905924 X:99576302-99576324 ACTGCTGGAGCTGAAGCAGCTGG - Intergenic
1194929397 X:99867812-99867834 ATGGCTGGAGCTGCAGCAGCTGG - Intergenic
1195779015 X:108440097-108440119 GCTGAAGGAGCTGCGGGAGCCGG + Exonic
1195803210 X:108735310-108735332 GATGCTGTAGCTGCGGCAGCGGG + Exonic
1196871560 X:120117112-120117134 AGTGCAGGAGCCACTGCACCAGG - Intergenic
1199586779 X:149423335-149423357 AGTGCAGAAGCTGCAGCTGATGG + Intergenic
1199616120 X:149657585-149657607 AGACCAGGCGCTGGGGCAGCAGG - Intergenic
1199626520 X:149745663-149745685 AGACCAGGCGCTGGGGCAGCAGG + Intergenic
1200093813 X:153648004-153648026 GGAGCAGGAGCCGCGGCCGCGGG - Exonic
1200110080 X:153736571-153736593 ATAGGAGGAGCTGGGGCAGCAGG - Intronic
1200181208 X:154151712-154151734 AGAGCAGGAGCTGCTGCTGCTGG - Intronic
1200186853 X:154188826-154188848 AGAGCAGGAGCTGCTGCTGCTGG - Intergenic
1200192504 X:154225964-154225986 AGAGCAGGAGCTGCTGCTGCTGG - Intronic
1200198259 X:154263768-154263790 AGAGCAGGAGCTGCTGCTGCTGG - Intronic
1200235304 X:154465146-154465168 GGTGCAGGGGCGGCAGCAGCGGG + Exonic
1200595508 Y:5135329-5135351 AGTACAGGAGCTGCTGCTGATGG + Intronic
1201454874 Y:14159010-14159032 AGTGCAGGAAAAGCGGAAGCTGG - Intergenic
1202367830 Y:24179016-24179038 AGTGCTAGAGCTGAGGCAGTTGG + Intergenic
1202502953 Y:25491107-25491129 AGTGCTAGAGCTGAGGCAGTTGG - Intergenic