ID: 1104811303

View in Genome Browser
Species Human (GRCh38)
Location 12:131621901-131621923
Sequence GCACTCCACGGAGCCTCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104811299_1104811303 -5 Left 1104811299 12:131621883-131621905 CCTGCTGCCGCAGCTCCTGCACT 0: 1
1: 0
2: 2
3: 47
4: 429
Right 1104811303 12:131621901-131621923 GCACTCCACGGAGCCTCGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 87
1104811297_1104811303 7 Left 1104811297 12:131621871-131621893 CCTCCTGGCTCTCCTGCTGCCGC 0: 1
1: 0
2: 5
3: 73
4: 658
Right 1104811303 12:131621901-131621923 GCACTCCACGGAGCCTCGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 87
1104811293_1104811303 28 Left 1104811293 12:131621850-131621872 CCTGGGCAAGAGCCACAGCCTCC No data
Right 1104811303 12:131621901-131621923 GCACTCCACGGAGCCTCGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 87
1104811298_1104811303 4 Left 1104811298 12:131621874-131621896 CCTGGCTCTCCTGCTGCCGCAGC 0: 1
1: 0
2: 2
3: 65
4: 624
Right 1104811303 12:131621901-131621923 GCACTCCACGGAGCCTCGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 87
1104811295_1104811303 16 Left 1104811295 12:131621862-131621884 CCACAGCCTCCTCCTGGCTCTCC No data
Right 1104811303 12:131621901-131621923 GCACTCCACGGAGCCTCGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 87
1104811296_1104811303 10 Left 1104811296 12:131621868-131621890 CCTCCTCCTGGCTCTCCTGCTGC No data
Right 1104811303 12:131621901-131621923 GCACTCCACGGAGCCTCGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104811303 Original CRISPR GCACTCCACGGAGCCTCGCC TGG Intergenic