ID: 1104811306

View in Genome Browser
Species Human (GRCh38)
Location 12:131621918-131621940
Sequence GCCTGGCCACACTCCCTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 314}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104811301_1104811306 5 Left 1104811301 12:131621890-131621912 CCGCAGCTCCTGCACTCCACGGA 0: 1
1: 0
2: 2
3: 30
4: 259
Right 1104811306 12:131621918-131621940 GCCTGGCCACACTCCCTGCACGG 0: 1
1: 0
2: 4
3: 42
4: 314
1104811297_1104811306 24 Left 1104811297 12:131621871-131621893 CCTCCTGGCTCTCCTGCTGCCGC 0: 1
1: 0
2: 5
3: 73
4: 658
Right 1104811306 12:131621918-131621940 GCCTGGCCACACTCCCTGCACGG 0: 1
1: 0
2: 4
3: 42
4: 314
1104811299_1104811306 12 Left 1104811299 12:131621883-131621905 CCTGCTGCCGCAGCTCCTGCACT 0: 1
1: 0
2: 2
3: 47
4: 429
Right 1104811306 12:131621918-131621940 GCCTGGCCACACTCCCTGCACGG 0: 1
1: 0
2: 4
3: 42
4: 314
1104811298_1104811306 21 Left 1104811298 12:131621874-131621896 CCTGGCTCTCCTGCTGCCGCAGC 0: 1
1: 0
2: 2
3: 65
4: 624
Right 1104811306 12:131621918-131621940 GCCTGGCCACACTCCCTGCACGG 0: 1
1: 0
2: 4
3: 42
4: 314
1104811302_1104811306 -3 Left 1104811302 12:131621898-131621920 CCTGCACTCCACGGAGCCTCGCC 0: 1
1: 0
2: 1
3: 7
4: 122
Right 1104811306 12:131621918-131621940 GCCTGGCCACACTCCCTGCACGG 0: 1
1: 0
2: 4
3: 42
4: 314
1104811296_1104811306 27 Left 1104811296 12:131621868-131621890 CCTCCTCCTGGCTCTCCTGCTGC No data
Right 1104811306 12:131621918-131621940 GCCTGGCCACACTCCCTGCACGG 0: 1
1: 0
2: 4
3: 42
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104811306 Original CRISPR GCCTGGCCACACTCCCTGCA CGG Intergenic