ID: 1104811309

View in Genome Browser
Species Human (GRCh38)
Location 12:131621920-131621942
Sequence CTGGCCACACTCCCTGCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 217}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104811302_1104811309 -1 Left 1104811302 12:131621898-131621920 CCTGCACTCCACGGAGCCTCGCC 0: 1
1: 0
2: 1
3: 7
4: 122
Right 1104811309 12:131621920-131621942 CTGGCCACACTCCCTGCACGGGG 0: 1
1: 0
2: 0
3: 30
4: 217
1104811304_1104811309 -9 Left 1104811304 12:131621906-131621928 CCACGGAGCCTCGCCTGGCCACA 0: 1
1: 0
2: 0
3: 18
4: 258
Right 1104811309 12:131621920-131621942 CTGGCCACACTCCCTGCACGGGG 0: 1
1: 0
2: 0
3: 30
4: 217
1104811298_1104811309 23 Left 1104811298 12:131621874-131621896 CCTGGCTCTCCTGCTGCCGCAGC 0: 1
1: 0
2: 2
3: 65
4: 624
Right 1104811309 12:131621920-131621942 CTGGCCACACTCCCTGCACGGGG 0: 1
1: 0
2: 0
3: 30
4: 217
1104811297_1104811309 26 Left 1104811297 12:131621871-131621893 CCTCCTGGCTCTCCTGCTGCCGC 0: 1
1: 0
2: 5
3: 73
4: 658
Right 1104811309 12:131621920-131621942 CTGGCCACACTCCCTGCACGGGG 0: 1
1: 0
2: 0
3: 30
4: 217
1104811296_1104811309 29 Left 1104811296 12:131621868-131621890 CCTCCTCCTGGCTCTCCTGCTGC No data
Right 1104811309 12:131621920-131621942 CTGGCCACACTCCCTGCACGGGG 0: 1
1: 0
2: 0
3: 30
4: 217
1104811301_1104811309 7 Left 1104811301 12:131621890-131621912 CCGCAGCTCCTGCACTCCACGGA 0: 1
1: 0
2: 2
3: 30
4: 259
Right 1104811309 12:131621920-131621942 CTGGCCACACTCCCTGCACGGGG 0: 1
1: 0
2: 0
3: 30
4: 217
1104811299_1104811309 14 Left 1104811299 12:131621883-131621905 CCTGCTGCCGCAGCTCCTGCACT 0: 1
1: 0
2: 2
3: 47
4: 429
Right 1104811309 12:131621920-131621942 CTGGCCACACTCCCTGCACGGGG 0: 1
1: 0
2: 0
3: 30
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104811309 Original CRISPR CTGGCCACACTCCCTGCACG GGG Intergenic