ID: 1104811311

View in Genome Browser
Species Human (GRCh38)
Location 12:131621929-131621951
Sequence CTCCCTGCACGGGGCAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104811299_1104811311 23 Left 1104811299 12:131621883-131621905 CCTGCTGCCGCAGCTCCTGCACT 0: 1
1: 0
2: 2
3: 47
4: 429
Right 1104811311 12:131621929-131621951 CTCCCTGCACGGGGCAGCTCAGG No data
1104811302_1104811311 8 Left 1104811302 12:131621898-131621920 CCTGCACTCCACGGAGCCTCGCC 0: 1
1: 0
2: 1
3: 7
4: 122
Right 1104811311 12:131621929-131621951 CTCCCTGCACGGGGCAGCTCAGG No data
1104811305_1104811311 -8 Left 1104811305 12:131621914-131621936 CCTCGCCTGGCCACACTCCCTGC 0: 1
1: 0
2: 5
3: 90
4: 681
Right 1104811311 12:131621929-131621951 CTCCCTGCACGGGGCAGCTCAGG No data
1104811304_1104811311 0 Left 1104811304 12:131621906-131621928 CCACGGAGCCTCGCCTGGCCACA 0: 1
1: 0
2: 0
3: 18
4: 258
Right 1104811311 12:131621929-131621951 CTCCCTGCACGGGGCAGCTCAGG No data
1104811301_1104811311 16 Left 1104811301 12:131621890-131621912 CCGCAGCTCCTGCACTCCACGGA 0: 1
1: 0
2: 2
3: 30
4: 259
Right 1104811311 12:131621929-131621951 CTCCCTGCACGGGGCAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104811311 Original CRISPR CTCCCTGCACGGGGCAGCTC AGG Intergenic