ID: 1104811737

View in Genome Browser
Species Human (GRCh38)
Location 12:131623593-131623615
Sequence GCTGCTGGTCAGTCAGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104811737_1104811743 18 Left 1104811737 12:131623593-131623615 CCAGGAGCTGACTGACCAGCAGC No data
Right 1104811743 12:131623634-131623656 AGCAGCAGTGCCAGATCAGATGG No data
1104811737_1104811744 22 Left 1104811737 12:131623593-131623615 CCAGGAGCTGACTGACCAGCAGC No data
Right 1104811744 12:131623638-131623660 GCAGTGCCAGATCAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104811737 Original CRISPR GCTGCTGGTCAGTCAGCTCC TGG (reversed) Intergenic
No off target data available for this crispr