ID: 1104812216

View in Genome Browser
Species Human (GRCh38)
Location 12:131626240-131626262
Sequence GGGCCGTGGGTGAAGTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104812216_1104812228 4 Left 1104812216 12:131626240-131626262 CCCCCCAACTTCACCCACGGCCC No data
Right 1104812228 12:131626267-131626289 AACTGCTGCTCCTGTCTTGCGGG No data
1104812216_1104812230 23 Left 1104812216 12:131626240-131626262 CCCCCCAACTTCACCCACGGCCC No data
Right 1104812230 12:131626286-131626308 CGGGATTTGCCACCTGTGCTTGG No data
1104812216_1104812227 3 Left 1104812216 12:131626240-131626262 CCCCCCAACTTCACCCACGGCCC No data
Right 1104812227 12:131626266-131626288 TAACTGCTGCTCCTGTCTTGCGG No data
1104812216_1104812231 26 Left 1104812216 12:131626240-131626262 CCCCCCAACTTCACCCACGGCCC No data
Right 1104812231 12:131626289-131626311 GATTTGCCACCTGTGCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104812216 Original CRISPR GGGCCGTGGGTGAAGTTGGG GGG (reversed) Intergenic
No off target data available for this crispr