ID: 1104812850

View in Genome Browser
Species Human (GRCh38)
Location 12:131628889-131628911
Sequence CAGCAGGTGCAGAGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104812850_1104812854 -8 Left 1104812850 12:131628889-131628911 CCCTCCTCACTCTGCACCTGCTG No data
Right 1104812854 12:131628904-131628926 ACCTGCTGGTCCTCAGCCCTTGG No data
1104812850_1104812856 -7 Left 1104812850 12:131628889-131628911 CCCTCCTCACTCTGCACCTGCTG No data
Right 1104812856 12:131628905-131628927 CCTGCTGGTCCTCAGCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104812850 Original CRISPR CAGCAGGTGCAGAGTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr