ID: 1104813605

View in Genome Browser
Species Human (GRCh38)
Location 12:131633458-131633480
Sequence TGGGAGTCAGCACAGACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104813605_1104813618 25 Left 1104813605 12:131633458-131633480 CCTGGGGTCTGTGCTGACTCCCA No data
Right 1104813618 12:131633506-131633528 TCTCCAGGCATAGTTACCCCTGG No data
1104813605_1104813608 -3 Left 1104813605 12:131633458-131633480 CCTGGGGTCTGTGCTGACTCCCA No data
Right 1104813608 12:131633478-131633500 CCACACCCACCTGCATCTCTTGG No data
1104813605_1104813620 27 Left 1104813605 12:131633458-131633480 CCTGGGGTCTGTGCTGACTCCCA No data
Right 1104813620 12:131633508-131633530 TCCAGGCATAGTTACCCCTGGGG No data
1104813605_1104813610 -1 Left 1104813605 12:131633458-131633480 CCTGGGGTCTGTGCTGACTCCCA No data
Right 1104813610 12:131633480-131633502 ACACCCACCTGCATCTCTTGGGG No data
1104813605_1104813611 0 Left 1104813605 12:131633458-131633480 CCTGGGGTCTGTGCTGACTCCCA No data
Right 1104813611 12:131633481-131633503 CACCCACCTGCATCTCTTGGGGG No data
1104813605_1104813617 10 Left 1104813605 12:131633458-131633480 CCTGGGGTCTGTGCTGACTCCCA No data
Right 1104813617 12:131633491-131633513 CATCTCTTGGGGGGGTCTCCAGG No data
1104813605_1104813609 -2 Left 1104813605 12:131633458-131633480 CCTGGGGTCTGTGCTGACTCCCA No data
Right 1104813609 12:131633479-131633501 CACACCCACCTGCATCTCTTGGG No data
1104813605_1104813612 1 Left 1104813605 12:131633458-131633480 CCTGGGGTCTGTGCTGACTCCCA No data
Right 1104813612 12:131633482-131633504 ACCCACCTGCATCTCTTGGGGGG No data
1104813605_1104813614 2 Left 1104813605 12:131633458-131633480 CCTGGGGTCTGTGCTGACTCCCA No data
Right 1104813614 12:131633483-131633505 CCCACCTGCATCTCTTGGGGGGG No data
1104813605_1104813619 26 Left 1104813605 12:131633458-131633480 CCTGGGGTCTGTGCTGACTCCCA No data
Right 1104813619 12:131633507-131633529 CTCCAGGCATAGTTACCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104813605 Original CRISPR TGGGAGTCAGCACAGACCCC AGG (reversed) Intergenic
No off target data available for this crispr