ID: 1104813614

View in Genome Browser
Species Human (GRCh38)
Location 12:131633483-131633505
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104813605_1104813614 2 Left 1104813605 12:131633458-131633480 CCTGGGGTCTGTGCTGACTCCCA No data
Right 1104813614 12:131633483-131633505 CCCACCTGCATCTCTTGGGGGGG No data
1104813602_1104813614 17 Left 1104813602 12:131633443-131633465 CCAGGCATAGTTACCCCTGGGGT No data
Right 1104813614 12:131633483-131633505 CCCACCTGCATCTCTTGGGGGGG No data
1104813604_1104813614 3 Left 1104813604 12:131633457-131633479 CCCTGGGGTCTGTGCTGACTCCC No data
Right 1104813614 12:131633483-131633505 CCCACCTGCATCTCTTGGGGGGG No data
1104813603_1104813614 4 Left 1104813603 12:131633456-131633478 CCCCTGGGGTCTGTGCTGACTCC No data
Right 1104813614 12:131633483-131633505 CCCACCTGCATCTCTTGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104813614 Original CRISPR CCCACCTGCATCTCTTGGGG GGG Intergenic
No off target data available for this crispr