ID: 1104813620

View in Genome Browser
Species Human (GRCh38)
Location 12:131633508-131633530
Sequence TCCAGGCATAGTTACCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104813616_1104813620 -2 Left 1104813616 12:131633487-131633509 CCTGCATCTCTTGGGGGGGTCTC No data
Right 1104813620 12:131633508-131633530 TCCAGGCATAGTTACCCCTGGGG No data
1104813606_1104813620 8 Left 1104813606 12:131633477-131633499 CCCACACCCACCTGCATCTCTTG No data
Right 1104813620 12:131633508-131633530 TCCAGGCATAGTTACCCCTGGGG No data
1104813613_1104813620 2 Left 1104813613 12:131633483-131633505 CCCACCTGCATCTCTTGGGGGGG No data
Right 1104813620 12:131633508-131633530 TCCAGGCATAGTTACCCCTGGGG No data
1104813605_1104813620 27 Left 1104813605 12:131633458-131633480 CCTGGGGTCTGTGCTGACTCCCA No data
Right 1104813620 12:131633508-131633530 TCCAGGCATAGTTACCCCTGGGG No data
1104813607_1104813620 7 Left 1104813607 12:131633478-131633500 CCACACCCACCTGCATCTCTTGG No data
Right 1104813620 12:131633508-131633530 TCCAGGCATAGTTACCCCTGGGG No data
1104813615_1104813620 1 Left 1104813615 12:131633484-131633506 CCACCTGCATCTCTTGGGGGGGT No data
Right 1104813620 12:131633508-131633530 TCCAGGCATAGTTACCCCTGGGG No data
1104813604_1104813620 28 Left 1104813604 12:131633457-131633479 CCCTGGGGTCTGTGCTGACTCCC No data
Right 1104813620 12:131633508-131633530 TCCAGGCATAGTTACCCCTGGGG No data
1104813603_1104813620 29 Left 1104813603 12:131633456-131633478 CCCCTGGGGTCTGTGCTGACTCC No data
Right 1104813620 12:131633508-131633530 TCCAGGCATAGTTACCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104813620 Original CRISPR TCCAGGCATAGTTACCCCTG GGG Intergenic
No off target data available for this crispr