ID: 1104814452

View in Genome Browser
Species Human (GRCh38)
Location 12:131637749-131637771
Sequence CAGGCTCAGGGCCCTGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104814444_1104814452 -5 Left 1104814444 12:131637731-131637753 CCCTGACCAGGCCTGGTTCAGGC No data
Right 1104814452 12:131637749-131637771 CAGGCTCAGGGCCCTGTGGGAGG No data
1104814438_1104814452 16 Left 1104814438 12:131637710-131637732 CCGGGGGGCGGCGTAGAGACCCC No data
Right 1104814452 12:131637749-131637771 CAGGCTCAGGGCCCTGTGGGAGG No data
1104814442_1104814452 -4 Left 1104814442 12:131637730-131637752 CCCCTGACCAGGCCTGGTTCAGG No data
Right 1104814452 12:131637749-131637771 CAGGCTCAGGGCCCTGTGGGAGG No data
1104814445_1104814452 -6 Left 1104814445 12:131637732-131637754 CCTGACCAGGCCTGGTTCAGGCT No data
Right 1104814452 12:131637749-131637771 CAGGCTCAGGGCCCTGTGGGAGG No data
1104814441_1104814452 -3 Left 1104814441 12:131637729-131637751 CCCCCTGACCAGGCCTGGTTCAG No data
Right 1104814452 12:131637749-131637771 CAGGCTCAGGGCCCTGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104814452 Original CRISPR CAGGCTCAGGGCCCTGTGGG AGG Intergenic
No off target data available for this crispr